QRT-PCR Analysis

Total RNA was extracted using Trizol reagent (Life Technologies, Grand Island, NY USA) according to the manufacturer’s instructions. QRT-PCR was conducted in the ABI 7500 Real-Time PCR system (Applied Biosystems, Weiterstadt, Germany) with reagents obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China). Total RNA (300 ng) from each condition was used for the first strand synthesis. PCR cycles were performed at the conditions as following: 95°C for 30s, 95°C for 5s and 60°C for 34s with 40 cycles, 95°C for 15s and 60°C for 1min and 95°C for 15s with 1 cycles. The QPCR primers for β-COP were GCAACTCAGAGTGCCCTTAGCA (forward) and GCAATCTTGGTCAGAGTTGTGGC (reverse) while primers for GAPDH were GTCTCCTCTGACTTCAACAGCG (forward) and ACCACCC TGTTGCTGTAGCCAA (reverse).