Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

AN Aidan M. Nikiforuk
TC Todd A. Cutts
ST Steven S. Theriault
BC Bradley W. M. Cook
request Request a Protocol
ask Ask a question
Favorite

RNA was extracted from viral supernatant using commercial reagents (Viral RNA Isolation Kit, Qiagen) and quantified by qRT-PCR (Lightcycler 480 RNA Master Hydrolysis Probes, Roche). Ebola virus RNA was detected by use of a 2:1 primer probe mix (300 nm, ZEBOV LF- CAGCCAGCAATTTCTTCCAT, ZEBOV LR-TTTCGGTTGCTGTTTCTGTG: 150 nm, ZEBOV LP1 -6FAM’-ATCATTGGCGTACTGGAGGAGCAG’MGBNFQ, ZEBOV LP2- 6FAM’-TCATTGGCGTACTGGAGGAGCAGG’MGBNFQ) specific for Zaire ebolavirus species. The conditions of the PCR reaction were programmed to: 61 °C for 3 min, 95 °C for 30 sec, 40 cycles of 95 °C for 15 sec and 60 °C for 40 sec. VSV-GFP RNA was detected by using a primer probe set targeting the nucleoprotein region (VSV-GFP NPF- CGGAGGGACGACTAATGC, VSV-GFP NPR-CGAGCGATTCGACCACATC, probe-6FAM’CGCCACAAGGCAG’MGBNFQ). The same thermo-cycling conditions were used.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A