Lentivirus transfection of WT cells

SZ Shibo Zhu
GL Guochang Liu
WF Wen Fu
JH Jinhua Hu
KF Kai Fu
WJ Wei Jia
ask Ask a question
Favorite

The short hairpin RNA (shRNA) that inhibits the Axl expression was designed and synthesized by ShangHai SBO Medical Biotechnology Company (Shanghai, China). The sequences are F: TAGTACCAGTGTTTGGTGTTTCTTCCTGTCAAAACACCAAACACTGGTACTGTTTTTTTC and R: TCGAGAAAAAAAGTACCAGTGTTTGGTGTTTTGACAGGAAGAAACACCAAACACTGGTACTGA. Then, the sh-Axl was inserted into the lentiviral vector pLL3.7 with T4 DNA ligases, and the vectors were transformed into Escherichia coli stbl3, which were resistant to ampicillin. Then, the correct vectors were cotransfected with psPAX2 and pMD2.G (GenePharma, Shanghai, China) in 293T cells using Xtreme (Roche, South San Francisco, CA, USA). Infectious lentiviruses were harvested at 48 h post-transfection and filtered through 0.45 μm polyvinylidene fluoride (PVDF) filters. Finally, these viruses were transfected into WT cells, and the transfected efficiency was detected using real-time quantitative polymerase chain reaction (RT-qPCR).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A