2.15. Real‐time quantitative RT‐PCR (RT‐qPCR)

Total RNA was isolated from cells collected from relevant experiments or from IP products with the TRIzol reagents. Complementary DNA (cDNA) was synthesized with a reverse transcription kit following the manufacturer's instruction, which was served as a template for RT‐qPCR using SYBR Green Master Mix. Primers for real‐time PCR were synthesized by Shanghai Sangon Biotech, including granzyme B (tgacagtgcaggaagatcga and ataggagacaatgccctggg), TTP (gactgagctatgtcggacct and ggttgtggatgaagtggcag), and IL‐10 (gccaagccttgtctgagatg and aagaaatcgatgacagcgcc). The amount of the target gene mRNA was calculated by the method of 2^−∆∆Ct and normalized against the housekeeping gene β‐actin mRNA.