Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Ask a
question
Favorite
Genomic DNA from blood was extracted to identify the sex of the embryo. Amplification was performed using CHD1 specific primers (CHD1-F: CTGCGAGAACGTGGCAACAGAGT; CHD1-R: ATTGAAATGATCCAGTGCTTG). The results showed that the hereditary female (ZW) had two strips at 580 and 423 bp, while the hereditary male (ZZ) had only one strip at 580 bp.
Copyright and License information: ©2022 Chen, Zhou, Lian, Jiang, Gao, Hu, Zuo, Zhang, Chen, Jin and Li.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
