Bioactivities of LJ-Derived PS

The RAW 264.7 cells, which are murine macrophages, were purchased from ATCC (Manassas, VA, United States), and the cellular toxicity of LJPS was determined by 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assays as described previously (33). Cells were cultured in high-Glc Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 1% P/S at 37°C in 5% CO₂. For MTT assay, cells (0.25 × 10⁶ cells/well) were seeded with serum-starved media (containing 1% FBS) in a 24-well plate. On the following day, the cells were treated with the different doses of LJPS for 6 h with or without lipopolysaccharide (LPS; Sigma-Aldrich, St. Louis, MO, United States; 100 ng/mL) for another 18 h. After removing the treatment media, 100 μl of 2 mg/ml MTT solution was added, and cells were incubated at 37°C for another 3 h. The medium was removed, and 100 μl of DMSO was then added. The absorbance was measured at 540 nm with a microplate reader (Molecular devices, San Jose, CA, United States). All materials for cell culture were purchased from Gibco (BRL, Gaithersburg, MD, United States).

RAW 264.7 cells (1 × 10⁶ cells/well) were plated in a 6-well plate. On the following day, the cells were treated with LJPS for 6 h and then stimulated with LPS (100 ng/ml) for another 18 h. At the end of incubation, the supernatant was collected to measure nitric oxide (NO) production with the Griess reagent (Sigma-Aldrich, St. Louis, MO, United States) as described elsewhere (33). Briefly, the supernatant (50 μl) was mixed with 50 μl of the Griess reagent in a 96-well plate and incubated at room temperature for 15 min. The nitrite concentrations were measured using a standard curve prepared from the different concentrations of sodium nitrite. Absorbance was measured at 540 nm with a microplate reader. The relative NO production was calculated based on the LPS-stimulated group, which was considered 100%. Total RNA was extracted from the RAW 264.7 cell using TRIzol reagent (Invitrogen, Carlsbad, CA, United States). cDNA synthesis was performed using an ABI High Capacity cDNA Archive kits (Thermo Fisher Scientific, CA, United States) according to the manufacturer’s instructions. cDNA samples were diluted with RNase Free Water, and real-time PCR was performed with SYBR (Bio-Rad^®, CA, United States), and specific targeting forward and reverse primers were as follows: tumor necrosis factor (Tnf)-α forward, GGCTGCCCCGACTACGT; Tnf-α reverse, ACTTTCTCCTGGTATGAGATAGCAAAT; interleukin (Il)-6 forward, CTGCAAGAGACTTCCATCCAGTT; and Il-6 reverse, AGGGAAGGCCGTGGTTGT. Relative gene expression, which was normalized to the levels of ribosomal protein lateral stalk subunit P0 (Rplp0, 36b4), was determined by real-time PCR (CFX96™Real-TimePCR Detection System, Bio-Rad, Hercules, CA, United States). In addition, ELISA was performed to detect IL-6 and TNF-α (BD PharMingen, San Jose, CA, United States) to measure secreted protein levels in supernatant collected from RAW 264.7 cells according to the manufacturer’s instructions. Absorbance was measured at 450–570 nm with a microplate reader.