2.3. Morpholino antisense oligonucleotide (MO) knockdown mice

MOs were administered via intrauterine injection, as previously described but with minor modifications. 19 , 27 Cyp26a1‐MO (5′‐CATGGCACGCCCCCTCCCGCGC‐3′) and Random Control‐MO (5′‐25‐N‐3′) were purchased from Gene Tools, LLC (Philomath, OR 97370, USA). MOs at a final concentration of 4 mM were prepared with sterile distilled water and stored at 25°C in a humid environment. At 8:30 AM, 30 nmol Cyp26a1‐MO or Random Control‐MO solution was injected into the uterine horn of anaesthetized GD4 mice. On GD6, the sacrificed mice were dissected and the uteri were collected for further analysis.