Human immortalized fibroblasts BJ hTert, BJ hTert shp53, BJ hTert HRasV12ER-Tam and BJ hTert HRasV12ER-Tam shp53 cells were obtained from R. Agami [68]. Human melanoma cell line A375 was from ATCC. Primary human normal fibroblasts (HNF) from dermal biopsies were obtained from A. Falk (Karolinska Institute). Cell authentication was performed by STR profiling analysis at Eurofin Genomics. Mycoplasma contamination was tested monthly using MycoAlert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s instructions. All experiments were performed within 10 passages from frozen stocks.
BJ hTert cells with stable STAT3 knock-down (BJ hTert shSTAT3), inducible p65 knock-down (BJ hTert shp65TET-ON) or ZMAT3 overexpression (BJ hTert pLV Wig-1; BJ hTert pLV Wig-1*H88A; BJ hTert pLV Wig-1-Flag) were generated by lentiviral transduction and selected 48 h with 2 μg/mL puromycine. Wig-1-overexpressing lentiviral vector (pLV Wig-1) was purchased from VectorBuilder. Site-directed substitution of Wig-1 Histidine 88 to Alanine and Flag tag insertion were introduced by quick change mutagenesis using pLV Wig-1 as matrix, using the following pairs of mutagenic primers: forward 5ʹ-gcccaggctgcttatcagggtaaaaatcatggtaagaaactccgaaattac-3ʹ and reverse 5ʹ- ccctgataagcagcctgggcttgctgtgcagagttcaaggtgacattgc-3 for H88A mutation; forward 5ʹ-gagatggagaatctgggatatgtaGATTATAAAGATGATGATGATAAAtagacccagctttcttgtacaaagtg-3ʹ and reverse 5ʹ- gctgggtctaTTTATCATCATCATCTTTATAATCtacatatcccagattctccatctcattcctgtaccgctgt-3ʹ for Flag insertion. STAT3 shRNA lentiviral vector (pGIPZ shSTAT3), Tet-inducible p65 shRNA lentiviral vectors (pTRIPZ shp65TET-ON) and their respective control vectors were purchased from Dharmacon. shRNA are detailed in Supplementary Table S2.
HRasV12 was induced in BJ-hTert HRasV12ER-Tam cells by adding 200 nM of 4-hydroxytamoxifen (4-OHT) (Sigma-Aldrich) to the culture medium. shRNA-mediated knock-down of p65 in BJ hTert shp65TET-ON cells was induced by 3 μg/mL of doxycycline (Sigma-Aldrich) for 48 h.
For experiments on PBMC-derived macrophages, monocytes were isolated from anonymous buffy coats of healthy blood donors (Karolinska University Hospital) using Ficoll gradient and centrifugation. Briefly, blood was diluted in PBS and layered on to Ficoll-Paque (GE Healthcare) and centrifuged at 1,200 rpm for 20 min. The interface layer containing the monocytes was collected and monocytes were further washed twice in PBS. Monocytes were then incubated 2 h for adhesion and unattached cells were washed with PBS. For differentiation into M1 and M2 macrophages, monocytes were cultured in RPMI 1640, 2 mM I-glutamine, 10% FBS, streptomycin/penicillin (Sigma-Aldrich) supplemented with increasing concentration of Granulocyte-Macrophage Colony-Stimulating (Sigma; up to 400 ng/ml) or Macrophage Colony-Stimulating Factor human (Sigma-Aldrich; up to 40 ng/ml) for 7 days.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.