CRISPR/Cas9-mediated STAG2 binding site deletion

Guide RNAs (gRNAs) targeting ~200 bp upstream and downstream sequence of STAG2/CTCF motif were designed using http://crispor.tefor.net/. For Site A, the two guide RNAs were: ACTGCCACCTCCCGTCTACT and GAAGCCCCGTCACTCCCGTG. For Site B, the two guide RNAs were: TTGGGTTCTACACTGTCAGG and CAGGCTGATGACGCCCCGAG. The potential deleted region was designed to be in the noncoding region (intron). gRNAs were cloned into the lentiCRISPR v2 backbone to generate multiplexed (2xsgRNA) lentiCRISPR_V2 by PCR cloning. As previously descried²¹, the sequence “U6 promoter-sgRNA1-scaffold-H1 promoter-sgRNA2” was introduced into the lentiCRISPR v2 backbone by two PCR reactions and a three-fragment ligation. After viral infection, single-cell clones of M14 were picked by sorting 7-AAD negative cells into a 96-well plate using a SONY SH800S cell sorter. Cell clones were screened for deletion of STAG2 binding sites by Sanger sequencing.