2.2. Generation of transgenic mice overexpressing mouse BCATm in the liver

A full-length mouse Bcat2 cDNA (GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"NC_000073.6","term_id":"372099103","term_text":"NC_000073.6"}}NC_000073.6) was cloned into pLIV.11 vector that contains the constitutive human apoE gene promoter and its hepatic control region, to direct the transgene expression in liver [23]. After digestion with SpeI and Sall, a fragment containing the human ApoE promoter, the mouse Bcat2 cDNA, the poly(A) signal from the human ApoE gene, and the hepatic control region, was isolated and microinjected into the male pronucleous of fertilized eggs from C57BL/6 females in the Transgenic Mouse Core Facility of Wake Forest University Health Sciences [24]. Ear DNA PCR analysis was performed to identify founder mice that harbored the integrated BCATm transgene in the liver. As a result, two female founder mice, with different levels of BCATm expression, were determined to exhibit germline transmission. Two transgenic mouse lines, with low and higher expression levels of the BCATm transgene in their liver (LivTg-LE [low expressor], LivTg-HE [high expressor], respectively), were confirmed by Western blotting and used in this study. They were maintained as hemizygotes by breeding with WT C57BL/6 mice, while nontransgenic WT littermates were used as controls. To genotype, ear DNA was lysed with an alkaline lysis reagent (25 mM NaOH, 0.2 mM EDTA) at 95°C for 1 h and neutralized with an equal volume of 40 mM Tris-HCl, and used for PCR analysis with the following primers: BCATmLivTgFor 5’ –ATGGCTGCAGCCACACTAGGA −3’; BCATmLivTgRev 5’ –GTGACCATACCAACACCCA −3’. A PCR product of 560 bp was produced from BCATmLivTg DNA, but not from WT DNA. Vldlr (very-low-density-lipoprotein receptor) was used as a positive loading control with the following primers: VldlrFor 5’ – GCAGATGAGTTCACTGGCTCC −3’; VldlrRev 5’ –AGGGCAGTTGACCTCATCGCT −3’ and with a PCR product of ~400 bp.