2.4. Cloning in pQE30 Vector

Subcloning in pQE30 vector was performed by the Gibson assembly method [38]. The pQE30 vector (Qiagen) and the Nanofitin-coding sequence initially embedded in pAFG12 were amplified by PCR using the pairs of oligonucleotides Gpls01-C (TAATGACTGAGCTTGGACTCC) and Gpls01N-Rev (GTGATGCGATCCTCTCATAG), or Gpls01Nsh-Fwd (CTATGAGAGGATCGCATCAC) and Gpls01C-Rev (GGAGTCCAAGCTCAGTCATTAATTAAGCTTTTTCTCGCGTTCCGC), respectively (Eurofins). Linearized vector (100 ng) was mixed with 3 molar equivalents of the gene insert in a final volume of 5 μL. Then, 15 μL of the Gibson assembly mix (25% PEG-8000 [MilliporeSigma], 500 mM Tris-HCl [MilliporeSigma], 50mM MgCl2 [MilliporeSigma], 50 mM dithiothreitol [MilliporeSigma], 1 mM Mix dNTPs [Thermo Fisher Scientific], 5 mM nicotinamide adenine dinucleotide [New England BioLabs, Ipswich, MA, USA], 2 U of T5 exonuclease [New England BioLabs], 12.5 U of Phusion polymerase [New England BioLabs], 2000 U of Taq ligase [New England BioLabs]) were added and the solution was incubated for 1 h at 50 °C. E. coli DH5α LacIq strains were transformed with 10 μL of the resulting material. Clones were selected on 2-YT medium plates containing 100 μg/mL ampicillin and 25 μg/mL kanamycin and further validated by Sanger sequencing (GATC Biotech, Constance, Germany).

Constructions of alanine scan variants followed a similar procedure, but the Nanofitin-coding sequence was constructed by 2 successive overlapping PCRs, as reported for the construction of the library.