4.2. Genetic analysis, mutagenesis and heterologous expression

Target sequencing was performed on Illumina MiSeq using Haloplex enrichment kit with a panel of 108 genes associated with inherited cardiac disorders as previously described [22]. All disease-related genetic variants were confirmed by Sanger sequencing and classified according to American College of Medical Genetics guidelines [23].

The pcDNA3.1 vector with WT hNa_v1.5 and GFP (hH1-pcDNA3.1) was kindly provided by Prof. Hugues Abriel (Institute of Biochemistry and Molecular Medicine, University of Bern, Bern, Switzerland). Site-directed mutagenesis was performed by the PCR amplification according to standard mutagenesis protocol with overlapped primers (TGTTGTCGTGCTCCAGCGCCATGAAGAGTGT; TGGAGCACGACAACATGACAAGTGAATTCG). hH1-pcDNA3.1 (1 μg) or Y739D-pcDNA3.1 (1 μg) were transfected into HEK293T cells growing on 3-cm plates using 1 mg/ml water solution of linear polyethylenimine hydrochloride (PEI, MW 40,000, Polysciences) at 2:1 v/w ratio with pDNA. The cells were maintained in the DMEM medium supplement 2 mM glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin (Thermo Fisher Scientific) in a CO₂ incubator at +37 °C for 24 h and then seeded at poly-Lysine (Sigma Aldrich) coated glasses for electrophysiological recordings.