RNA was isolated from cells using the RNeasy Mini kit (Qiagen, ♯74104) and Xbp1 bands (both spliced and unspliced) from MEFs were amplified directly with primers (Fwd-5′GAAGAGAACCACAAACTCCA 3′; Rev-5′GGATATCAGACTCAGAATCT 3′) using OneStep RT-PCR Kit (Qiagen, ♯210210). Fragments were analysed by gel electrophoresis using 2.5% agarose gel in TAE buffer. 26 base pairs are excised out from unspliced Xbp1 to yield the spliced fragment.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.