The qPCR was performed for each of the high and low concentration predator filtrate samples of B. bacteriovorus to enumerate the total copy number of the 16S rRNA gene (492 bp conserved locus-specific to the Bdellovibrionaceae family) based on a previously developed protocol (51).
The total 16S rRNA gene copy number of a sample was determined by comparison with a standard curve of known concentrations of a plasmid containing the 16S rRNA gene. The number of cells was inferred from the value of the total copy number based on reports of Bdellovibrio having an approximate copy number of 2 16S rRNA genes per cell (71).
To amplify a fragment of 492 bp of the B. bacteriovorus HD100 16S rRNA gene to use as a standard for qPCR, PCR was performed on pure cultures using a protocol previously developed (51). The PCR contained 12.5 μL of PCR master mix (Lambda Biotech), 1 μL of each primer (10 μm; BbSF216: 5′‐TTTCGCTCTAAGATGAGTCCGCGT‐3′ and BbSF707: 5′‐TTCGCCTCCGGTATTCCTGTTGAT‐3′) previously designed (72), 2 μL of DNA, and 8.5 μL of PCR grade water. Positive (Bdellovibrio DNA) and negative (no DNA) controls were included.
The PCR was performed with a GeneTouch thermal cycler (Bioer) using a thermal profile of denaturation and enzyme activation at 95°C, 2 min, followed by 36 cycles of 95°C for 30 s, annealing at 51°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min. PCR products were verified by gel electrophoresis (1% agarose gel in 0.5%) Tris acetate-EDTA (TAE) buffer stained with 10 μL of SYBR Safe DNA gel stain (Thermofisher) at 110 V for 1 h, and the gel was digitized with a Gel Doc XR+ imager (Bio-Rad).
The standard fragment was then cloned with the pGEM-T easy plasmid vector system (Promega). The DNA was quantified using a NanoDrop ND-1000 UV-Vis Spectrophotometer (Thermofisher) and a 10-fold dilution series for the standard curve was prepared from 9 to 9 × 106 plasmid copies per reaction using a calculation previously described (51). qPCR for the standard curve was always performed in combination with the qPCR assays for the Bdellovibrio samples.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.