Transposon mutagenesis and transposon sequencing.

M. tuberculosis H37Rv was mutagenized with the mariner himar1 transposon using the temperature-sensitive mycobacteriophage phAE180³⁰. Approximately 2 × 10⁵ independent transposon-mutagenized bacilli were spread on Middlebrook 7H9 medium supplemented with 10% (vol/vol) OADC and 0.2% (vol/vol) glycerol containing 1.5% agar (Difco) and 50 μg mL⁻¹ kanamycin, without or with 50 μg mL⁻¹ POA (Sigma), in 245-mm² BioAssay dishes (Nunc). For analysis of individual POA-resistant strains, secondary plating was performed on supplemented 7H10 medium without or with 400 μg mL⁻¹ POA.

For transposon sequencing, plates were incubated for 2 weeks, colonies were collected, and genomic DNA was extracted as previously described (37). Briefly, colonies were scraped into 10 mL of 7H9 complete medium, and the mycobacteria were pelleted and incubated at 80°C for 2 h. Cultures were pelleted, resuspended, and washed in 500 μL of 25 mM Tris (pH 7.9), 10 mM EDTA, and 50 mM glucose. The cells were resuspended in 450 μL of 25 mM Tris (pH 7.9), 10 mM EDTA, and 50 mM glucose with 50 μL of 10 mg mL⁻¹ lysozyme. Samples were incubated at 37°C for 16 h. Next, 100 μL of 10% SDS and 50 μL of 10 mg mL⁻¹ proteinase K were added, and the mixture was incubated at 55°C for 30 min. Two hundred microliters of 5 M NaCl and 160 μL of CTAB saline solution (0.7 M NaCl, 0.275 M hexadecyl-trimethylammonium bromide [CTAB]) were added, and the samples were incubated at 65°C for 10 min.

DNA was extracted using multiple chloroform-isoamyl alcohol treatments. The DNA was precipitated with isopropanol and washed with 70% ethanol prior to its resuspension in EB buffer (Qiagen). DNA fragmentation and Illumina P7 adapter (CAAGCAGAAGACGGCATACGAGAT) ligation were performed in the NeoPrep library prep system (Illumina). Transposon junctions were amplified by using a transposon-specific primer, Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC), and primer P7 (CAAGCAGAAGACGGCATACGAGAT) with a HotStarTaq master mix kit (Qiagen). The following PCR conditions were used: 94°C for 3 min, 19 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 30 s, and 72°C for 10 min. The himar1-enriched samples were diluted 1:50 and amplified by using a P5 indexing primer (AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC; [i5] barcode sequence) and a P7 primer HotStarTaq master mix kit (Qiagen) to add unique barcodes and the necessary P5 and P7 flow cell adapter sites for Illumina sequencing. The following PCR conditions were used: 94°C for 3 min, 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s.

Sequencing was performed on an Illumina MiSeq system by the University of Minnesota Genomics Center. Transposon and adapter sequences were trimmed from the 5′ end of sequencing reads using Cutadapt (68). We also discarded all the sequence reads that did not contain adapter sequence in the 5′ trimming process. After the 5′ trimming process, all the sequence reads begin with TA. Adapter sequences were trimmed and sequence reads that were shorter than 18 bp were discarded. The default error rate of 0.1 was used for all trimming processes. The trimmed sequence reads were mapped (allowing 1 bp mismatch) to the M. tuberculosis H37Rv genome (GenBank no. {"type":"entrez-nucleotide","attrs":{"text":"AL123456.3","term_id":"444893469","term_text":"AL123456.3"}}AL123456.3) using Bowtie (69). The genome-mapped sequence reads were printed in SAM format, and sequence reads per each TA dinucleotide site in the M. tuberculosis H37Rv genome were counted using SAMreader_TA script (70).

The relative abundance of read counts for each TA site was calculated relative to total read counts for the respective library. Fold change in relative abundance of each TA site was determined by dividing mean relative abundance from the POA data set by mean relative abundance from the 7H9 data set. P values comparing relative abundance of TA sites without and with POA were determined by using a two-tailed paired Student's t test. Mean fold change in abundance per locus was determined by calculating the mean fold change in relative abundance of each TA site for a given locus. Overall P value per locus was determined by using Fisher’s combined probability test for each TA site within a given locus.