request Request a Protocol
ask Ask a question
Favorite

Total RNA was extracted from glioma cells or xenografts using TRIzol reagent. cDNA was reverse transcribed using a PrimeScript RT reagent kit (Takara). The qRT–PCR system was prepared using SYBR Premix Ex Taq II (RR820A, Takara). Reactions were carried out in a 384-well plate under the following settings: (94 °C for 5 s, 60 °C for 34 s, and 72 °C for 30 s) for 40 cycles. The reaction was performed on an ABI 7900 system (ABI, USA). In this experiment, the internal references were U6 and GAPDH. The relative expression level was calculated using the 2−∆∆Ct method. The primers used in this study were as follows: miR-376a-5p, (forward) 5′-GCCGCGTAGATTCTCCTTCTA-3′ and (reverse) 5′- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACTCA-3′; SIRT1, (forward) 5′-CAGTGGCTGGAACAGTGAGA-3′ and (reverse) 5′-TCTGGCATGTCCCACTATCA-3′; YAP1, (forward) 5′-TGACCCTCGTTTTGCCATGA-3′ and (reverse) 5′-TGACCCTCGTTTTGCCATGA-3′; VEGF, (forward) 5′-GGGCAGAATCATCACGAAGT-3′ and (reverse) 5′-TGGTGATGTTGGACTCCTCA-3′; GAPDH, (forward) 5′-CCAGGTGGTCTCCTCTGA-3′ and (reverse) 5′-GCTGTAGCCAAATCGTTGT-3′; and U6, (forward) 5′-CTCGCTTCGGCAGCACA-3′ and (reverse) 5′-AACGCTTCACGAATTTGCGT-3′.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A