2.1. Plasmids

YT Yeu-Yang Tseng
CK Chih-Ying Kuan
MM Masaki Mibayashi
CC Chi-Jene Chen
PP Peter Palese
RA Randy A. Albrecht
WH Wei-Li Hsu
request Request a Protocol
ask Ask a question
Favorite

The plasmid pCAGGS-NS1 encoding the full-length NS1 sequence of A/Puerto Rico/8/1934 (PR8), NS1 R38A/K41A, NS1 E96A/E97A, NS1 ∆1-73 (N), or NS1 ∆74-230 (C) was previously described [16,24,25]. Plasmid FLAG-NS1 was obtained by cloing IAV PR8 NS1 amplified by PCR using primers with Nhe I and Xba I sequences at each end (NheI-NS1-FLAG-PR8-F: 5’-GGCCGCTAGCATGGATCCAAACACT GTGTCAA-3’ and XbaI-NS1-FLAG-PR8-R: 5’-GGCCTCTAGATCAAACTTCTG ACCTAATTGT-3’) into p3xFLAG-CMV-14 vector (Sigma-Aldrich, Saint Louis, MO, USA) linearized with corresponding restriction enzymes.

Plasmids expressing HA-tagged wild-type MAVS and deletions of CARD, PRD, or transmembrane domain (TMD) (namely ΔCARD, ΔPRD and ΔTMD) were provided by P.P. To generate plasmids expressing human MAVS and its variants with deletion of TM domain tagged with an HA sequence at the C-terminus, the inserts were respectively amplified by PCR from human A549 cDNA using a primer set (NheI-MAVS-F: 5′-TCGA GCTAGC ATGCCGTTTGCTGAAGACA-3′ with XbaI-MAVS-R: 5′-ACTCTAGACTACCCGGGGGCATAATCTGGCACATCATAAGGGTAGTAGTGCAGACGCCGCCGGTACAG-3’ or XbaI-MAVS-TM-R: 5′-AC TCTAGACTACCCGGGGGCATAATCTGGCACATCATAAGGGTAGTAGTGCAGACGCCGCCGGTACAGAGGTGAGGGCCTGTGGCATGGC-3′). The cDNA of full-length MAVS or ΔTM was digested by Nhe I and Xba I enzymes at 37 °C for 1 h and then ligated with pcDNA3.1 plasmid digested with corresponding enzymes.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A