2.5. Generation of KO Cell Lines Using the CRISPR/Cas9 Gene Editing Technology

A549 KO GABARAPL1 cell lines were generated using the CRISPR/Cas9 gene editing technology. A549 wild-type cells were transfected with the pCAS9-GFP-sgRNA GABARAPL1a (sgRNA sequence: CACCGCCGGAAGAAATATCCGGAC) or the pCAS9-GFP-sgRNA GABARAPL1b (sgRNA sequence: AAACGTCCGGATATTTCTTCCGGC), targeting two distinct sites of the first exon of GABARAPL1, leading to the generation of the A549 KO GABARAPL1 c1 (A549 KO GL1 c1) and A549 KO GABARAPL1 c3 (A549 KO GL1 c3) cell lines, respectively. ACHN wild-type cells were transfected with the pCAS9-GFP-sgRNA GABARAPL1b plasmid, leading to the generation of the ACHN KO GABARAPL1 cA and ACHN KO GABARAPL1 cB cell lines. A549c and ACHNc cells were generated following transfection with the pCAS9-GFP-sgRNA control plasmid. The day after transfection, GFP-positive cells were sorted by FACS (SH800, SONY) and colonies were expanded before being screened for the loss of GABARAPL1 expression by Western blotting and sequencing. For A549c and ACHNc control cells, all of the GFP-positive cells were pooled and, therefore, these cell lines correspond to polyclonal cell lines.

For transient transfection, the pCAS9-GFP-sgRNA control or the pCAS9-GFP-sgRNA GABARAPL1 plasmids were transfected using the jetPRIME reagent (Polyplus-transfection, 114-07), according to the manufacturer’s protocol.

For sequencing analysis, genomic DNA from A549c, ACHNc, and KO GL1 clones was extracted (DNeasy blood and tissue kit, 69504) and amplified by PCR (for A549 KO GL1 c1: F- CGGTGCATCATGAAGTTCCA and R- CTCCGCTCCTCTACACTCAC; and for A549 KO GL1 c3, and ACHN KO GL1 cA and cB: F- GCCCTGCGGTGCATCAT and R- CATCCCCTCCGCTCCTCTACACT). PCR products were cloned into the p.JET1.2 vector (Thermo Fisher, 10659920) following the manufacturer’s instructions. JM109 bacteria were transformed with the ligation product and grown on ampicillin LB medium. At least 10 colonies were sequenced (SANGER sequencing on 3130 GA Applied Biosystems).