After completion of behavioral tests, rats in the CUS and control groups were randomly selected for virus injection. Different groups of rats were randomly selected by non-participants. The AAV9-virus was obtained from GENEchem (Shanghai, China). The AAV9-rno-miR-204-5p virus (primer sequence: UUCCCUUUGUCAUCCUAUGCCU) was constructed to overexpress miR-204-5p while the AAV9-rno-miR-204-5p-sponge virus (inverse complementary sequence: AGGCATAGGATGACAAAGGGAA) was used to block miR-204-5p in the DG region of the hippocampus. Rats were anesthetized with an intraperitoneal injection of 2.5% isoflurane as based on their body weights and then positioned within the stereotaxic apparatus (Stoelting, USA). Small burr holes were drilled on two sides of the skull (3.24 mm posterior to bregma and 1.8 mm lateral to the midline) to allow access to the hippocampal DG region for injection of the AAV virus (~ 1012 infection units per ml, a flow rate of 140 nl/min) at the depth of 3.5 mm. Behavioral tests or biochemical assays were performed at ≥ 14 days after injection. The injection sites were verified after behavioral tests and only rats with correct injection sites were used for analyses in the subsequent assays.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.