Generation of Smcr8βgeo/βgeo mutant mice

The Smcr8^{tm1(KOMP)Vlcg} ES cells were obtained from the University of California, Davis, Knockout Mouse Project Repository. Smcr8 locus is partially replaced by a cassette containing lacZ-polyA followed by a loxP-flanked hUbCpro-neo-polyA sequence. The Mouse Genetic Core Facility at National Jewish Health at Denver, CO, performed the ES cell injections into C57BL/6N blastocysts. The chimeric offsprings were mated to 129S1/SvImJ mice for germline transmission; germline-transmitted heterozygous females were crossed with CMV-Cre males to remove the Neo cassette. The PCR primers used for genotyping are as follows: LacF, acttgctttaaaaaacctcccaca; Smcr8-R, tgaacgaagactgctgtgtttaccc; Smcr8-wtR, gtcagtgttttccactccgaagtcc; and Smcr8-wtF, agaagcctatgcggataatgagggg. All animals were handled according to protocols approved by the Institutional Animal Care and Use Committee at the University of Georgia, Athens.