MS2 VLP Plasmid construction and expression system

MS2 VLP expression vector was prepared by amplifying the MS2 Coat and a part of maturase DNA sequences from the pMS27 Plasmid (BCCM/LMBP plasmid Collection, Cabri, Belgium) (Table ​(Table11)¹⁸. The amplified sequence was inserted in-frame into pACYCDuet plasmid (Novagen, Gibbstown, NJ, USA) through BamH1 and HindIII restriction enzyme (Thermo Fisher Scientific Inc., USA) sites. The oligonucleotide sequence encoding the shRNA sequence was designed by siRNA Wizard ™software (Invivogen, USA) (Table ​(Table1).1). The synthesized shRNA (Macrogen Inc., South Korea) fused to four repeats of MS2 bacteriophage pac sequence (Macrogen Inc., South Korea) was sub-cloned into the other multiple cloning sites of pACYCDuet plasmid through BglII and Kpn1 restriction enzyme (Thermo Fisher Scientific Inc., USA) sites (Fig. 4e). This sequence (shRNA-4pac, Table ​Table1)1) was used as a control RNA sequence with the ability to be packed into VLP in each step, plasmid construction was verified by Sanger sequencing (Macrogen Inc., South Korea) and was named the SC Duet.

Primers and oligonucleotides used in this study.

MS27.Fw

MS27.Rev

CGGGATCCTGGCTATCGCTGTAGGTAGCC

CCCAAGCTTATGGCCGGCGTCTATTAGTAG

AGATCTGGATCCGGCCTACTCGAACCGTTGATTTCAAGAGAATCAACGGTTCGAGTAGGCCATATGTAA

CGATCGTAATTGCCTAGAAAACATGAGGATTACCCATGTCTGCAGGTCGACTCTAGAAAACATGAGGAT

TACCCATGTCTGCAGGTCGACTCTAGAAAACATGAGGATTACCCATGTCTGCAGGTCGACTCTAGAAAAC

ATGAGGATTACCCATGTCTGCAGTATTCCCGGGTTCATTTACGTACTAGCATAACCCCTTGGGGCCTCTAA

ACGGGTCTTGAGGGGTTTTTTGGGTACC

CCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTACGTAAATGAACCCGGGA

ATACTGCAGACATGGGTAATCCTCATGTTTTCTAGAGTCGACCTGCAGACATGGGTAATCCTCATGTTTTC

TAGAGTCGACCTGCAGACATGGGTAATCCTCATGTTTTCTAGAGTCGACCTGCAGACATGGGTAATCCTC

ATGTTTTCTAGGCAATTACGATCGTTACATATGGCCTACTCGAACCGTTGATTCTCTTGAAATCAACGGTT

CGAGTAGGCCGGATCCA

VLP.Fw

VLP.Rev

CCTACTCGAACCGTTGATTTCAAGAG

TGCAGACATGGGTAATCCTCATG

The SC Duet plasmid was introduced into the BL21(DE3) strain of E. coli Bacteria as a prokaryotic expression system. The Ecoli BL21(DE3)-SC Duet was cultured in a terrific broth medium at 37 °C, supplemented with 34 µg/ml chloramphenicol (pACYCDuet antibiotic selection). The expression of the sequences was induced by 1 mM IPTG (isopropyl β-d-1-thiogalactopyranoside, Thermo Fisher Scientific Inc., USA) at an OD ₆₀₀ = 0.6 for 16 h at 22 °C. Bacteria were precipitated by centrifugation (6000 g, 20 min, 4 °C), and the derived precipitate was resuspended in the appropriate buffer (in 1/5th of the initial bacterial culture volume). Lysozyme treatment (0.05 mg ml^-1) was performed for 30 min at room temperature followed by sonication (total time: 3 min, 51 W). Cell debris was collected by centrifugation (13500 g, 20 min, 4 °C). The supernatant containing VLPs was filtered through a 0.22 µm membrane (Jet Bio-Filtration Co, China) and stored at 4 °C for further examination². To eliminate cell debris, the suspension was filtered through a 0.1 µm membrane (Sartorius, Germany) and then MS2 VLPs were purified according to the polyethylene glycol (PEG) precipitation method⁴⁴. In brief, the precipitation of VLPs was performed by adding PEG (MW: 6000, Sigma Aldrich, USA) at 10% of the final concentration (w/v) and 500 mM NaCl. The suspension was incubated at 4 °C for 18 h and subsequently was centrifuged at 10000 g for 1 h, 4 °C. The pellet containing MS2 VLPs was resuspended in the buffer used in the first step of purification (in 1/10th of the initial resuspension volume). Eventually, this MS2 VLP suspension was filtered through a 0.22 µm membrane (Jet Bio-Filtration Co, China). All MS2 VLP samples were kept at 4 °C. Solutions of 1 mM, and 100 mM NaNO3 (Merck & Co., Inc. USA), 1 M Tris (Sigma Aldrich, USA) buffer, and HEPES Buffer (Biowest, France) were prepared fresh, one day before experiments.