Generation of EGFR KO stable cells by CRISPR/Cas9.

EGFR knockout cells were generated using the CRISPR/Cas9 system. Two single guide RNA (sgRNA) off-target sequences, obtained from the GenScript Biotech database (sgRNA1, TGAGCTTGTTACTCGTGCCT, and sgRNA2, GAGTAACAAGCTCACGCAGT), were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, Massachusetts, USA) as described by Ran et al. (54). Afterwards, A549 cells were transfected with the plasmids containing either the sgRNA or off-target sequences by a standard calcium phosphate transfection. At 48 h posttransfection, cells were selected with 1.5 μg/ml puromycin (Sigma-Aldrich, St. Louis, MO). Monoclonal EGFR KO cells were expanded and characterized by Western blotting, immunofluorescence, and DNA sequencing.