2.2. Luciferase Constructs and Reporter Assay

The MSH2 3′ UTR of a carrier of the mutation c.*226 A>G was amplified by PCR with a primer pair containing XhoI and NotI restriction sites as already described. Oligonucleotide sequences were as follows: XhoI-3′ UTR MSH2 forward: ATACTCGAGAAAATCCCAGTAATGGAATG and NotI-3′ UTR MSH2 reverse: ATAGCGGCCGCTTCAAATTCCACAAACTACA. The PCR product was cloned into the PSICHECK2 vector (Promega, Madison, WI, USA) downstream of the Renilla luciferase coding region (hRluc). The orientation of the wild-type (WT) and mutated (MUT) inserted products was established by digestion and confirmed by sequencing. The PSICHECK2 constructs with additional mutations in the target site for miR-137 were generated using the QuiKChange Mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA). Oligonucleotide sequences for site-directed mutagenesis were as follows: 3′UTR MSH2 MUT1 forward, GGACTGTTTGCAATTGACATAGGTACTgATAAGTGATGTGCTG and reverse, CAGCACATCACTTATcAGTACCTATGTCAATTGCAAACAGTCC; 3′UTR MSH2 MUT2 forward, GGACTGTTTGCAATTGACATAGGTCCGgATAAGTGATGTGCTG, and reverse, CAGCACATCACTTATcCGGACCTATGTCAATTGCAAACAGTCC (seed region is underscored, patient mutated base is in lowercase, and additional mutated bases are in bold, Figure 1A). Luciferase activity was measured 48 h after transfection using a dual luciferase reporter assay (Promega) according to manufacturer’s instructions and performed on a 20n/20n luminometer (Turner BioSystems, Sunnyvale, CA, USA). Relative luciferase activity was calculated by normalizing the Renilla luminescence to the firefly luminescence [29].

Luciferase MSH2 3′UTR constructs and luciferase reporter assay. (A) Wild-type (WT) and mutant MSH2 3′UTR reporter constructs are shown, aligned with the native miR-137 sequence. MSH2 target sequences complementary to the miR-137 seed region are shown in bold and mutated bases are underlined. (B) Schematic representation of luciferase reporter gene construct. Constructs were cloned into the PSICHECK2 vector (Materials and Methods). (C) Reporter luciferase activity in WT and mutated (MUT, MUT1, MUT2) MSH2 3′UTR was measured in SW480 cells after transfection with pre-miR-137 and pre-miR scramble, (SCR) reagents. Data were normalized to Firefly luciferase activity. Values are expressed in percentages as the mean ± standard deviation (SD) of 4 samples assayed in 3 independent experiments (* p < 0.05; ** p < 0.0001).