qRT‐PCR was performed as previously described [29]. Briefly, cells were lysed with 1 mL TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CA, USA). cDNA was synthesized with PrimeScript™RT reagent Kit (TaKaRa, Shiga, Japan), then amplified by using SYBR Premix EXtaq (TaKaRa). PCR reactions were run using 2 μL of cDNA product by incubating for 30 s at 95°C, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. All samples were normalized to GAPDH. The primers for AURKA, PD‐L1, GAPDH, interleukin (IL)‐4, IL‐10, transforming growth factor (TGF)‐β, interferon‐γ (IFN‐γ), IL‐2, MYC, granzyme B (GZMB), and perforin were as follows: AURKA: forward, 5’‐GGAATATGCACCACTTGGAACA‐3’, reverse, 5’‐TAAGACAGGGCATTTGCCAAT‐3’; PD‐L1: forward, 5’‐GGACAAGCAGTGACCATCAAG‐3’, reverse, 5’‐CCCAGAATTACCAAGTGAGTCCT‐3’; GAPDH: forward, 5’‐ACAACTTTGGTATCGTGGAAGG‐3’, reverse, 5’‐GCCATCACGCCACAGTTTC‐3’; IL‐4: forward, 5’‐CGGCAACTTTGTCCACGGA‐3’, reverse, 5’‐TCTGTTACGGTCAACTCGGTG‐3’; IL‐10: forward, 5’‐TCAAGGCGCATGTGAACTCC‐3’, reverse, 5’‐GATGTCAAACTCACTCATGGCT‐3’; TGF‐β: forward, 5’‐CTAATGGTGGAAACCCACAACG‐3’, reverse, 5’‐TATCGCCAGGAATTGTTGCTG‐3’; IFN‐γ: forward, 5’‐TCGGTAACTGACTTGAATGTCCA‐3’, reverse, 5’‐TCGCTTCCCTGTTTTAGCTGC‐3’; IL‐2: forward, 5’‐TCCTGTCTTGCATTGCACTAAG‐3’, reverse, 5’‐CATCCTGGTGAGTTTGGGATTC‐3’; MYC: forward, 5’‐TCCCTCCACTCGGAAGGAC‐3’, reverse, 5’‐CTCGGTGCATTTTCGGTTGTTG‐3’; GZMB: forward, 5’‐TACCATTGAGTTGTGCGTGGG‐3’, reverse, 5’‐GCCATTGTTTCGTCCATAGGAGA‐3’; perforin: forward, 5’‐GACTGCCTGACTGTCGAGG‐3’, reverse, 5’‐TCCCGGTAGGTTTGGTGGAA‐3’.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.