DNA extraction and molecular identification of S. sclerotiorum and S. subarctica

Sclerotinia spp. cultures were initiated from stock sclerotia and incubated on PDA at 20°C for 3–4 days to produce actively growing colonies. Three agar plugs were taken from the leading edge, placed into Petri dishes containing half strength PDB, and incubated at 20°C for 3 days. The agar plugs were then removed and the mycelial mat washed twice in sterilized reverse osmosis (RO) water and blotted dry on tissue (KimTech; Kimberly-Clark Ltd, UK) before being freeze-dried overnight. Genomic DNA was extracted from the freeze-dried mycelium using a DNeasy Plant Mini Kit (Qiagen Ltd, UK) following the manufacturer's protocol.

S. subarctica and S. sclerotiorum isolates were distinguished by PCR amplification of the large subunit of the ribosomal DNA (LSU), where a large (304 bp) intron is absent in S. subarctica compared to S. sclerotiorum (Holst-Jensen et al., 1998). The 25 μl PCR reaction mixture consisted of 1 x REDTaq ReadyMix PCR reaction mix (Sigma-Aldrich, UK), LR5 and LROR primers (0.4 μmol L⁻¹; (Vilgalys and Hester, 1990) and ~10 ng DNA template. Thermal cycling parameters were 94°C for 2 min; 35 cycles of 94°C for 60 s, 52°C for 60 s, 72°C for 60 s; 72°C for 10 min and then a hold at 12°C. PCR products were visualized on a 1.5% agarose gel with a DNA ladder (EasyLadder I, Bioline Reagents Ltd, UK). Isolates associated with the smaller sized amplicons were identified as S. subarctica and this was further confirmed by PCR amplification and sequencing of the rRNA ITS region. Here, the PCR reaction mixture of 25 μl consisted of 1 x REDTaq ReadyMix PCR reaction mix (Sigma-Aldrich, UK), modified standard ITS primers (White et al., 1990) for S. sclerotiorum ITS2AF (TCGTAACAAGGTTTCCGTAGG) and ITS2AR (CGCCGTTACTGAGGTAATCC; 0.4 μmol L⁻¹) and approximately 10 ng DNA template. Thermal cycling parameters were 94°C for 2 min; 40 cycles of 94°C for 15 s, 59°C for 15 s, 72°C for 30 s; 72°C for 10 min and then a hold at 12°C. PCR products were visualized on a 1.5% agarose gel to confirm amplification, purified using the QIAquick PCR purification kit (Qiagen, UK), and sequenced (ITS2AF/ITS2AR primers) by GATC Biotech (Germany). ITS sequences obtained for all the S. subarctica isolates were aligned using the ClustalW algorithm implemented in MEGA v6 (Tamura et al., 2013) and sequence identity was confirmed by BLASTn analysis.