Bacterial strains.

Coxiella burnetii Nine Mile phase II (plaque-purified clone 4; RSA 439) (50) and Legionella pneumophila serogroup 1-derived strains were used in all experiments (74). For C. burnetii infections, acidified citrate cysteine medium (ACCM-2) (75) was inoculated with wild-type (WT) C. burnetii, WT C. burnetii expressing mCherry (76), an icmL::Tn strain (33) that contains a transposon insertion in the icmL gene rendering the T4SS nonfunctional, and WT and icmL::Tn strains harboring plasmids carrying blaM alone or blaM fused to the gene encoding the known T4SS substrate CBU_0077 under the control of the CBU_1169 promoter (33). All NMII strains were grown at 37°C in 5% CO₂ and 2.5% O₂ for 6 days to late log phase (∼1.0 × 10⁹ bacteria/ml). One day after inoculation, kanamycin (275 μg/ml) was added to icmL::Tn cultures and chloramphenicol (3 μg/ml) was added to strains harboring plasmids encoding BlaM or BlaM-0077 fusion proteins (30). To quantify C. burnetii genome equivalents (GEs) for infection of macrophages, C. burnetii genomic DNA was isolated with the illustra bacterial genomic prep mini spin kit (GE Healthcare), and genomic equivalents were measured by quantitative PCR (qPCR) of the C. burnetii dotA gene using SYBR green, the CFX96 qPCR machine (Bio-Rad Laboratories), and the following primers: dotA 5′ (GCGCAATACGCTCAATCACA) and dotA 3′ (CCATGGCCCCAATTCTCT). The L. pneumophila ΔdotA mutant (74), ΔflaA mutant (72), and ΔdotA and ΔflaA strains harboring pSS128, encoding a BlaM-RalF fusion protein (77) on the Lp02 (thyA) background, which is a thymidine auxotroph derived from strain Lp01, were cultured as a heavy patch on charcoal yeast extract agar containing thymidine for 48 h at 37°C. Lp02 strains harboring the BlaM reporter proteins were grown in the presence of chloramphenicol (6.75 μg/ml).