In Situ Hybridization

Probes were generated as previously described²⁹ with the following modifications. Primers to make to make probe templates: Vegfa forward (TGTCTACCAGCGAAGCTACT), Vegfa reverse (TCGTTTAACTCAAGCTGCCT), Vegfr2 forward (ATTCAGAGCGATGTGTGGTC), Vegfr2 reverse (GTCTGTCTGGCTGTCATCTG), Sema3C forward (ATCGGCAGTGTGTGTGTATC), Sema3C reverse (GAACCTAGAGCAAGAGTGGC), Sema3E forward (GGCAAGTATGGAACCACCAA), Sema3E reverse (CTGGAGCAGGATATGCCATC). In vitro transcription mixture was composed of 1 μg cDNA, 4 μL 10× T7 or SP6 buffer (Roche, Pleasanton, CA, USA), 4 μL T7 or SP6 RNA polymerase (Roche), 1 μL RNase inhibitor (Roche), 4 μL digoxigenin or fluorescein deoxyribose nucleotide triphosphates (dNTPs) (Roche) and RNase free water to 40 μL. Samples were incubated at 37°C overnight and 4 μL LiCl, 4 μL ethylenediaminetetraacetic acid (EDTA), and 150 μL EtOH was added to the samples. RNA was chilled at −80°C and resuspended in 20 μL RNase free water.

Tissues for hybridization were prepared by fixing P14 from Dscam mutant and wild-type littermate enucleated and hemisected eyes (cornea and lens removed) in 4% paraformaldehyde with 5% sucrose at RT for 30 minutes. Retinas were then dissected out of the eye cup and washed three times for 10 minutes in phosphate buffer with 5% sucrose. Tissues were cryopreserved by equilibrating them in 30% sucrose and then embedded and frozen down in a 2:1 mixture of optimal cutting temperature compound (OCT, Sakura Finetek USA, Inc., Torrance, CA, USA): 30% sucrose. Tissues were sectioned at 6 μm using a cryostat and were placed onto charged slides. Slides were then dried overnight in a desiccator at RT. Hybridization was prepared as previously described.^30,31