RAD library construction and sequencing

Young leaves were collected from each sample and then frozen at −80°C. Total genomic DNA was extracted from each sample using the modified CTAB method as described by Doyle and Doyle (1987). Genomic DNA from each sample was quantified using spectrophotometry (Qubit 2.0 Fluorometer, Invitrogen) and checked for genomic integrity by 0.8% agarose gel electrophoresis.

Restriction-site associated DNA (RAD) strategy combined with Illumina DNA sequencing was used for the fast and effective identification of SNP markers. RAD libraries were constructed following a protocol from Baird et al. (2008). The general protocol was as follows: first, each sample of genomic DNA (~0.5 μg per sample) from the 168 individuals and their two parents was digested with 20 units (U) of EcoRI or Sbf I (New England Biolabs, NEB) for 15 min at 37°C in a 50-μL (microlitre) reaction and then heat denatured at 65°C. P1 Adapters, each with a unique 4–8 bp (base pair) molecular-identifying sequence (MID), were ligated to the genomic DNA of each sample. The adapter sequences were as follows: EcoRI digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′, for Sbf I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′, bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoRI buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H₂O. Samples were treated with heat denaturation at 65°C for 20 min again. The pooled samples of each library were randomly cut to DNA fragments of 400–700 bp. The size of sheared DNA was isolated through 1% agarose gel electrophoresis using a DNA gel extraction kit (Tiangen, China). The ends of the DNA were blunted by using the Quick Blunting Kit (NEB). After purifying the samples using a DNA purification kit (Tiangen), 15 U of Klenow exo⁻ (NEB) was added for adenine (Fermentas) overhangs on the 3′end of the DNA at 37°C. Then, 1 μL P2 Adapter (10 nM) was ligated to the DNA fragments at RT. Samples were again purified and eluted in 50 μL. Five microlitres of this product was used in a PCR amplification along with 50 μL Phusion Master Mix (NEB), 40 μL H₂O and 5 μL primer mix (10 μM) (P1-forward primer: 5′-AATGATACGGCGACCACCGA-3′; P2-reverse primer: 5′-CAAGCAGAAGACGGCATACGA-3′). The PCR enrichment was carried out following instructions (NEB) for 11 cycles in total. Samples were gel purified, excising DNA 400–700 bp, and diluted to 10 nM.

Each library of the RAD products from the 170 individuals was sequenced on an individual lane of the Illumina HiSeq2000 next-generation sequencing platform (BGI-Shenzhen, Shenzhen, P.R. China). Sequencing data for each individual were then obtained in terms of the specific MID. Raw sequences are available in the National Centre for Biotechnology Information (NCBI) Sequence Read Archive (SRA) database under the accession number SRR5097134.