RT-qPCR.

Total RNA from cells was purified using a Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA) according to the manufacturer's instructions. The RNA concentration was determined with an ND-1000 spectrophotometer (NanoDrop). Total RNA (500 ng) was reverse transcribed by using a high-capacity reverse transcription (RT) kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions. RT-quantitative PCRs (RT-qPCRs) were performed in an ABI Prism 7900 HT real-time PCR system (Thermo Fisher Scientific). The PCR conditions were as follows: 95°C for 10 min, 95°C for 15 s, and 60°C for 1 min for 40 cycles. The following primers were used in RT-qPCR analysis: for hCXCL9, CCACCCGAACGTCTTATCTAATC (forward) and GTGGGTCACAGACTCTCAAAT (reverse); for hCXCL10, TCTCCCATCACTTCCCTACAT (forward) and GGAGTAGTAGCAGCTGATTTGG (reverse); for hCCL13, CAGAGGCTGAAGAGCTATGTG (forward) and CAGATCTCCTTGCCCAGTTT (reverse); and for hCCL17, GAGTACTTCAAGGGAGCCATTC (forward) and TGCCCTGCACAGTTACAAA (reverse). The results were analyzed using the software (SDS, version 2.3) provided by the instrument. The relative expression of the genes was calculated by the threshold cycle (2^−ΔΔCT) formula using SFRS-9 as a normalizer. The values reported are means for at least three biological replicates, each with three technical replicates.