Quantification of the Fusarium oxysporum and fungal abundances

Real-time quantitative polymerase chain reaction (qPCR) was performed according to Chen et al. (2014) for quantifying the soil Fusarium oxysporum and fungi abundances using the SYBR Premix Ex Taq Kit on the ABI PRISM 7500 Real Time PCR System (Applied Biosystems, Germany). The 20 μl reaction mixture contained 10 μl of the Premix Ex Taq™ (2 ×) (Takara), 0.4 μl of each primer (10 μM), 0.4 μl of ROX Reference Dye II (50 ×), 2 μl of template DNA, and 6.8 μl of ddH₂O. The specific primer set of F. oxysporum and soil fungi was AFP308R (CGAATT AACGCGAGTCCCAAC)/ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Lievens et al., 2006) and ITS2 (GCTGCGTTCTTCATCGATGC)/ITS1F (CTTGGTCATTTA GAGGAAGTAA), respectively. The thermal conditions were set as follows: 30 s at 95°C for initial denaturation, 40 cycles of 5 s at 95°C, and 34 s at 60°C. The standard curve was obtained using a 10-fold dilution series of plasmid DNA containing a fragment of the ITS region of F. oxysporum and ITS1 gene from the F. oxysporum f. sp. vanillae and soil samples, respectively. All amplifications were performed in triplicate. The specificity of the products was confirmed by a melting curve analysis and agarose gel electrophoresis. The copy numbers were log₁₀-transformed to normalize the values prior to statistical analysis.