DNA sonication, end-repair, A-tailing, and library amplification

Agarose plugs were then melted and dissolved. DNA was sonicated using to a median shear length of 170 bp using a Covaris S220 sonicator for 4 min at 10% duty cycle, peak incident power 175, 200 cycles per burst, 4 °C. Following the sonication, DNA was precipitated with ethanol and dissolved in 70 μL TE buffer. 35 μL of Dynabeads were washed twice with 1 mL Binding and Wash Buffer (1xBWB) (10 mM Tris-HCl pH8.0, 1 mM EDTA, 1 M NaCl, 0.1% Tween20). After the wash, beads were recovered using a DynaMag-2 magnetic separator (12321D, Invitrogen) and supernatants were discarded. Washed beads were resuspended in 130 μL 2xBWB (10 mM Tris-HCl pH8.0, 2 mM EDTA, 2 M NaCl) combined with the 130 μL of sonicated DNA followed by an incubation at 24 °C for 30 min. Next, the supernatant was removed, and the biotinylated DNA bound to the beads was washed thrice with 1 mL 1xBWB, twice with 1 mL EB buffer, once with 1 mL T4 ligase reaction buffer (NEB) and then resuspended in 50 μL of end-repair reaction mix (0.4 mM of dNTPs, 2.7 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB) and 1 U of Klenow fragment (NEB)) and incubated at 24 °C for 30 min. Once again, the supernatant was removed using a magnetic separator and beads were then washed once with 1 mL 1xBWB, twice with 1 mL EB buffer, once with 1 mL NEBNext dA-Tailing reaction buffer (NEB) and then resuspended in 50 μL of with NEBNext dA-Tailing reaction buffer (NEB) and 20 U of Klenow fragment exo- (NEB). The A-tailing reaction was incubated at 37 °C for 30 min. The supernatant was removed using a magnetic separator and washed once with 1 mL NEBuffer 2 and resuspended in 115 mL of Ligation reaction with Quick Ligase buffer (NEB), 6,000 U of Quick Ligase (NEB) and ligated to “END-seq hairpin adapter 2” by incubating the reaction at 25 °C for 30 min. Reaction was stopped by adding 50 mM of EDTA, and beads washed 3X BWB, 3X EB, and eluted in 8 μL of EB. Hairpin adapters were digested using USER enzyme (NEB, M5505S) at 37 C for 30 min. PCR amplification was performed in 50 μL reaction with 10 mM primers 5′-CAAGCAGAAGACGGCATACGA-GATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC^∗T-3′ and 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC^∗T-3′, and 2X Kapa HiFi HotStart Ready mix (Kapa Biosciences). ^∗ represents a phosphothioratebond and NNNNNN a Truseq index sequence. PCR program: 98 °C, 45 s; 15 cycles [98 °C, 15 s; 63 °C, 30 s; 72 °C, 30 s]; 72 °C, 5 min. PCR reactions were cleaned with AMPure XP beads, and after running the reactions on a 2% agarose gel, 200-500 bp fragments were isolated. Libraries were purified using QIA-quick Gel Extraction Kit (QIAGEN). Library concentration was determined with KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems) and the sequencing was performed on Illumina NextSeq 500 or 550 (75 bp single end reads).