Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Competition assay

LB Lisa L. Berglund
XH Xinxin Hao
BL Beidong Liu
JG Julie Grantham
TN Thomas Nyström
request Request a Protocol
ask Ask a question
Favorite

Cells were first grown as individual cultures to mid log in SD-ura 2% raffinose. Equal cell numbers from each culture were then combined in a new culture and samples for PCR and Western blot analysis were taken. Galactose with a final concentration of 2% was added, after which the cells were allowed to grow at 30 °C for five days. Samples were taken before a daily dilution of the culture to an OD of 0.1. For quantifying the gene ratio of HTT103QP/HTT25QP, primers were designed to anneal outside the polyQ stretch in the HTT-GFP constructs (Htt N17 fw: GGCCTTCGAGTCCCTCAAAA and int GFP rev: CTTGTAGTTGCCGTCGTCCT). PCR was performed with purified total DNA from the mixed culture as template. PCR products were subsequently run on a 1% agarose gel. Protein ratios of Htt103QP/Htt25QP were measured in parallel by making a whole cell extract.

Copyright and License information: The Author(s) ©2017
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A