TP53 knockout using CRISPR/Cas9 technology

TP53 knockout JH-EsoAd1 cell line was generated as previously described³. Briefly, a dual lentiviral vector expression system consisting of a constitutive Cas9 endonuclease (FUCas9) and an inducible sgRNA (FGT1-UTG) vector, linked to a mCherry and GFP reporter respectively, were utilized to perform CRISPR/Cas9-mediated TP53 knockout. Two sgRNA sequences were designed to target exon 4 (GGCAGCTACGGTTTCCGTCT) and 5 (GAGCGCTGCTCAGATAGCGA) of TP53 using MIT CRISPR software (http://crispr.mit.edu) and subsequently cloned into BsmBI restriction sites on FGT1-UTG. Lentiviral particles were produced from HEK-293T cells using Lenti-X (Clontech) packaging mix according to manufacturer's instructions. JH-EsoAd1 cells were transduced with FUCas9 and sorted for mCherry-positive cells followed by transduction with FGT1-UTG and sorted for GFP-positive cells. sgRNA induction with doxycycline (2 μg ml⁻¹) was undertaken for 72 h before single cell sorting to generate clonal cell lines for each sgRNA. p53 status was verified by western blot and TP53 knockout confirmed by MiSeq sequencing.