2.8. Single Guide RNA Design, CRISPR/Cas9 Treatment of Patient iPSCs, and Cell Cloning

Single guide RNA (gRNA), AATTCTGCAATCCTCACTCT with a PAM sequence of GGG, was designed at the proximity of mutation site c.2299 by bioinformatic tools on the University of California, Santa Cruz genome browser and chemically synthesized by Synthego. The ribonucleoprotein (RNP) complex of Cas9 and sgRNA was prepared by incubating Cas9 protein (Integrated DNA technologies, Coralville, Iowa, 1.5 μM) and sgRNA (2 μM) at room temperature for 15 min. The sequence of the repair homology template was 5′ TAATGATGTTGGATGTGAGCCCTGCCAGTGTAACCTCCATGGCTCAGTGAACAAATTCTGCAATCCTCACTCTGGACAGTGTGAGTGCAAAAAAGAAGCCAAAGGACTTCAGTGTGACACCTGCAGAGAAAACTTTTATGGGTTAGATGTCAC 3′ (Integrated DNA Technologies).

Nucleofections were performed as previously described [27], patient-derived iPSCs were cultured until reaching 70~80% confluence on vitronectin coated 6-well plates in E8 medium. One hour before nucleofection, 10 μM ROCK- inhibitor Y27632 were added to the medium, then cells were dissociated by Accutase (Thermo Fisher A1110501) at 37 °C for 6–8 min and collected by centrifugation at 900 rpm for 3 min. Cells were counted, then washed by PBS and collected by centrifugation at 900 rpm for 3 min. Then, 0.2~0.4 million cells were resuspended in 20 μL P3 reagent, P3 Primary Cell 4D-Nucleofector^TM X Kit L (Lonza, Basel, Switzerland) with RNP. Next, 4 μM ssODN was used for a single nucleofection event and cells were nucleofected by the program CM-119 in Lonza nucleofector 4D (Lonza, Basel, Switzerland).

After nucleofection, 50% of iPSCs (0.1~0.2 million) were plated on a well of a vitronectin pre-coated 24-well plate in E8 medium. The other 50% iPSCs were plated on 6-well plates at low density (2000~20,000 cells per well). Then, 10 μM Y27632 were used for the first 24 h and gradually reduced to 1 μM over the next 3 days. Seventy-two hours after the nucleofection, cells in the 24-well plate were collected and genomic DNA was extracted by DNeasy kit (Qiagen, Germantown, MD, USA). PCR reactions were conducted with primers flanking the mutation site: forward primer (USH2AdelF, GGTGTGATCATTGCAATTTTGG) and reverse primer (USH2AdelR, CCCTGTCTTAGCATTACAGACAGTC). The PCR products were extracted using a PCR purification kit (Qiagen) and sent for next generation sequencing (NGS). Ten to fourteen days after the nucleofection, single colonies were picked from the 6-well plate and expanded. Genomic DNA was collected and PCR reactions were conducted and sequenced using the Sanger method.