4.5. Site-Directed Mutagenesis

PCR-based site-directed mutagenesis (Stratagene, Cedar Creek, TX, USA) was used to introduce the novel mutation p.M124V in the complete wild-type GBA cDNA cloned in the pcDNA3 vector, following the manufacturer’s instructions. The oligonucleotides containing the specific mismatches were Primer Forward: GGATTTGGAGGGGCCGTGACAGATGCTGCTG and Primer Reverse: CAGCAGCATCTGTCACGGCCCCTCCAAATCC. The mutant construct was completely sequenced to confirm that no mutations other than p.M124V were introduced by the mutagenesis procedure.