PCR-based site-directed mutagenesis (Stratagene, Cedar Creek, TX, USA) was used to introduce the novel mutation p.M124V in the complete wild-type GBA cDNA cloned in the pcDNA3 vector, following the manufacturer’s instructions. The oligonucleotides containing the specific mismatches were Primer Forward: GGATTTGGAGGGGCCGTGACAGATGCTGCTG and Primer Reverse: CAGCAGCATCTGTCACGGCCCCTCCAAATCC. The mutant construct was completely sequenced to confirm that no mutations other than p.M124V were introduced by the mutagenesis procedure.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.