Viral quantification (RNA and titer)

After infection, total RNA was extracted from cells using the NEB Monarch total RNA miniprep kit or RNEasy 96 Kit (Qiagen, 74181) for HCoV-229E infections. For SARS-CoV-2 and PDCoV infections, cells were resuspended in TRIzol reagent followed by RNA isolation using either traditional phase separation with chloroform or Direct-zol RNA miniprep kit. HCoV-229E viral RNA was quantified using either a custom primer-probe set (FW: GGTAAGAGAGGTGGTGGTAATG, RV: TGGTCAACAAACTGCCATAAATC, Probe: /56-FAM/CATAACAGG/ZEN/TTTGCCATCGGCGC/3IABkFQ/) or a commercial Taqman probe (Thermo, Vi06439671_s1). SARS-CoV-2 viral RNA was quantified using a synthesized primer-probe set based on the sequences provided by the CDC “Research Use Only 2019-Novel Coronavirus (2019-nCoV) Real-time RT-PCR Primers and Probes” set N1. PDCoV viral RNA was quantified using a custom primer-probe set (FW: TCTACCCTCGTGCCACTATTA, RV: CTCTGTGATTTGCTTGCCTTTAG, Probe: /56-FAM/CAACTAAGC/ZEN/CTCTGTCTGCTGCCA/3IABkFQ/). All viral RNA was normalized to endogenous 18S rRNA. To determine HCoV-229E and SARS-CoV-2 titer, cells were infected for 1 hour at 37°C. Viral inoculum was then removed and medium was replaced with the appropriate fresh viral infection medium. Infections were incubated for 48 hours, then viral supernatant was collected and titer was determined via plaque assays.