Cloning and generation of transgenic lines

All transcriptional and translational reporter constructs were generated by double or triple Multisite Gateway Technology (Thermo Fisher Scientific). ENTRY plasmids containing cell type–specific promoters (pEN-L4-IRT1p-L3, pEN-L4-PEPp-L3, pEN-L4-SCRp-L3, pEN-L4-WOLp-L3, and pEN-L4-PIN1p-L3) were described in (30) and obtained from NASC. pEN-L4-JAZ10p-R1, pEN-L1-NLS-3xVEN-L2, and pEN-R2-CIT-L3 were as in (6, 58). CIT and mTurquoise (mT) fluorophores were subcloned into pDONR221 or pDONR-P2R-P3 to obtain pEN-L1-CIT-L2 and pEN-R2-mT-L3. Promoters were amplified from WT genomic DNA with oligonucleotides containing adequate restriction sites for KOR1p (GATGATGCTCTCTGATAAAGC and AAGTCTTTTGGGAGCTGCAA; 2.132 kb) and ESMD1p (ATCGACAGATCTCAATCTC and GGACGAGGACATCCTTGGTA; 2.168 kb) and cloned into pUC57 to create pEN-L4-promoter-R1 clones, as described (58). Coding DNA sequences of KOR1 (ATGTACGGAAGAGATCCATG and TCAAGGTTTCCATGGTGCTG) and ESMD1 (ATGCTAGCGAAGAATCGG and GGTGGCAGGAGGTGGTCTC) were amplified from WT complementary DNA with oligonucleotides specified in parenthesis containing appropriate att sites and recombined with pDONR221 or pDONR-P2R-P3 to obtain pEN-L1-KOR1-L2, pEN-L1-ESMD1-L2, and pEN-R2-KOR1-L3. For transcriptional reporters, pEN-L4-JAZ10p-R1 and pEN-L4-ESMD1-R1 were recombined with pEN-L1-NLS-3xVEN-L2 into pEDO097, as described (58). pEN-L4-KOR1p-R1 was also recombined with pEN-L1-KOR1-L2 into pEDO097 for complementation analysis. For translational reporters, pEN-L4-KOR1p-R1 or cell type–specific promoters were recombined with pEN-L1-CIT-L2 and pEN-R2-KOR1-L3 into a modified pH7m34gw vector named pFR7m34gw, which harbors seed red fluorescent protein (RFP) expression (OLE1p:RFP) instead of Hg resistance for in planta selection, to generate promoter:CIT-KOR1 constructs. Similarly, to obtain ESMD1p:ESMD1-mT and ESMD1p:ESMD1-CIT, we recombined pEN-L4-ESMD1p-R1, pEN-L1-ESMD1-L2, and pEN-R2-mT-L3 or pEN-R2-CIT-L3 into pFR7m34gw (in both cases, fluorescence signals were undetectable, although the constructs were functionally complementing the mutant phenotype). All constructs were verified by Sanger sequencing, and transgenic plants were generated by floral dip with Agrobacterium tumefaciens strain GV3101. Transformed seeds expressing RFP in T₁, T₂, and T₃ generations were selected by fluorescence microscopy, and segregation analysis was performed in >12 independent T₂ lines. A minimum of two independent T₃ transgenic lines were used for each construct to perform experiments and verify reproducibility.