2.2. Transfection of expression plasmid, short hairpin RNA (shRNA) and small interfering RNA (siRNA)

For stable transfection of shRNAs, the cell lines were transfected by the lentiviral transduction method, as previously described [⁴⁶]. Briefly, virus particles were produced by cotransfecting pCMV‐VSV‐G, pCMVΔ8.2 and the shRNA‐ or ORF‐containing vector into HEK293T cells. The virus was harvested 48 h after transfection and then added to the pre‐seeded target cell lines. The stable cell lines were selected using 2 μg/mL puromycin (Thermo Fisher Scientific, Waltham, MA, USA) or 10 μg/mL blasticidin (Thermo Fisher Scientific, Waltham, MA, USA) 24 h after virus infection.

For transient transfection of siRNAs or miRNA inhibitors, 5×10⁵ cells per well were pre‐coated into a six‐well plate, then plasmids, siRNAs, or miRNA inhibitors were transfected into the cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. The transfected cells were harvested after 24 h to 48 h and were used for analyses.

YB1 open reading frame (ORF) fragments were obtained from pCMV‐YB1‐myc vector (GeneCopoeia, Wuhan, China). Then, YB1 ORFs were subcloned into pLOC lentivirus vector (Invitrogen, Carlsbad, CA, USA) and SFB (S‐protein, Flag tag and streptavidin‐binding peptide)‐tagged expression vector. Similarly, the truncated YB1 constructs were produced by subcloning the truncated YB1 domains into the SFB‐tagged expression vector. The pre‐miR‐205 and pre‐miR‐200b expressing plasmids were purchased from the GeneCopoeia company (Wuhan, China). Flag‐tagged DGCR8, Flag‐tagged Dicer, Flag‐tagged TUT4, and Flag‐tagged TUT1 plasmids were kindly provided by Dr. V. Narry Kim (School of the Biological Sciences, Seoul National University, Korea). The human YB1 shRNA plasmids were purchased from Sigma Company (St. Louis, MO, USA). shRNA sequences used in this study were as follows: 5′‐CCGGCCAGTTCAAGGCAGTAAATATCTCGAGATATTTACTGCCTTGAACTGGTTTTTG‐3′ designated for shYB1_4 (Catalog No. TRCN0000315307); 5′‐CCGGAGCAGACCGTAACCATTATAGCTCGAGCTATAATGGTTACGGTCTGCTTTTTTG‐3′ designated for shYB1_5 (Catalog No. TRCN0000315309). Snail siRNA (si‐Snail) and negative control (si‐NC) were obtained from GenePharma Company (Shanghai, China). siRNA sequences used in this study were as follows: 5′‐GCCUUCAACUGCAAAUACUTTAGUAUUUGCAGUUGAAGGCTT‐3′ for si‐Snail; 5′‐UUCUCCGAACGUGUCACGUTT‐3′ for si‐NC. Snail shRNA was produced by cloning Snail shRNA sequence into pLKO.1 lentiviral vector. Snail shRNA sequence: 5′‐CCGGCGCTTTGAGCTACAGGACAAACTCGAGTTTGTCCTGTAGCTCAAAGCGTTTTT‐3′.