Oligonucleotide Synthesis

Synthesis and purification of all chemically modified oligonucleotides were performed as previously described (31). The MOE [2′-O-(2-Methoxyethyl)] gapmer ASOs are 18 (or 20) nucleotides in length, wherein the central gap segment comprising eight (or ten) 2′-deoxyribonucleotides is flanked on the 5′ and 3′ wings by five 2′ MOE modified nucleotides. Internucleotide linkages are phosphorothioate interspersed with phosphodiester, and all cytosine residues are 5′-methylcytosines. The sequence of the ASOs are as follows: Control-ASO, 5′- CCTATAGGACTATCCAGGAA−3′; HDAC6-ASO, 5- GCCTACTCTTTCGCTGTC-3′.