DNA extraction and PCR reactions

RS Rajesh K. Shandil
SC Swarup K. Chakrabarti
BS Bir Pal Singh
SS Sanjeev Sharma
SS S. Sundaresha
SK Surinder K. Kaushik
AB Arvind K. Bhatt
NS Nitya Nand Sharma
request Request a Protocol
ask Ask a question
Favorite

Genomic DNA was isolated from leaves of young shoots using GenElute™ Plant Genomic DNA Mini Prep Kit (Sigma Aldrich). Template DNA from each young plant of 271 F1seedlings was extracted for PCR confirmation of RB gene. Multiplex PCR reaction (20 μL) was performed using 1 U of Taq DNA polymerase (Bangalore GeNei™, India), 100 ng of genomic DNA, 1X PCR Buffer (MgCl2 free), 2 mM MgCl2, 160 μM dNTP, 0.50 μM of each MAMA primers (MAMAF: CATCTTGAGAGAGTGAAGAATGATCT and MAMAR: CTAGTGCGCAACACAATTGAA) and 0.10 μM of each RP2 primers (RP2F: TCGTGGATTTTTCCGATCTC and RP2R: ATCTCGCTCCATCTCTCCAA) with the following amplification conditions: 94 °C for 5 min; 35 cycles comprising of 94 °C for 1 min, 55 °C for 30 s, and 72 °C for 1 min;and final extension at 72 °C for 10 min. The RB gene insert was also analyzed using N-terminal and C-terminal primers. PCR reaction (20 μL) was performed using 1 U of Taq DNA polymerase (Bangalore GeNeiTM, India), 100 ng of genomic DNA, 1X PCR Buffer, 1.5 mM MgCl2, 160 μM dNTP, 0.20 μM of each N-terminal primers (RBNF: CTCATTTTACCCCTACAA and RBNR: GCGTTTTGGACCCTTTTA) and 0.20 μM of each C-terminal primers (RBCF: TAAGCATGAGTTGGAATAACT and RBCR: GCCAGTCTTCTCCTATTCCCT) with amplification conditions as mentioned above. After completion of PCR, reaction products were loaded on 1% of agarose gel (containing ethidium bromide 0.5 μg/mL) prepared in 1 X TAE buffer, and electrophoresed at 100 V for 2 h. Gel documentation was performed under UV light using a Fluor-STMMultiImager (BIO-RAD).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A