A Method for User-defined Mutagenesis by Integrating Oligo Pool Synthesis Technology with Nicking Mutagenesis

Materials and Reagents

1. 245 mm Square BioAssay Dishes (Corning^®, catalog number: 431111 )
2. PCR Tubes (e.g., VWR, catalog number: 52509-304 )
3. Glass Pasteur pipette
4. Scraper
5. 50 ml conical tube (e.g., Thermo Fisher, catalog number: 14-432-22 )
6. High-efficiency electrocompetent E. coli cells (essential that these are > 10⁹ CFU/μg plasmid DNA, e.g., Agilent XL-1-Blue Electroporation Competent Cells) (Agilent, catalog number: 200228 )
7. Oligo pool containing mutagenic oligos (or manually pooled mutagenic oligos), e.g., Agilent SurePrint Oligonucleotide Libraries
8. Single primer that anneals to the template strand at a non-mutagenized location with an opposite orientation compared with mutagenic oligos (synthesized by e.g., Integrated DNA Technologies)
9. Plasmid to mutagenize containing a single BbvCI restriction site (multiple BbvCI restriction sites are acceptable as long as all are in the same orientation)
   We have successfully mutagenized plasmids up to 8 kb in length. The plasmid pEDA5-GFPmut3-Y66H described in Wrenbeck et al. (2016) (Addgene ID 80085) is a useful control (see Note 3).
10. Monarch^® PCR & DNA Cleanup Kit (5 μg) (New England BioLabs, catalog number: T1030S/L )
11. Miniprep kit (e.g., Monarch^® Plasmid Miniprep Kit, New England BioLabs, catalog number: T1010S )
12. T4 Polynucleotide Kinase (New England BioLabs, catalog number: M0201S/L )
13. Nt.BbvCI (New England BioLabs, catalog number: R0632S/L )
14. Nb.BbvCI (New England BioLabs, catalog number: R0631S/L )
15. Exonuclease I (E. coli) (New England BioLabs, catalog number: M0293S/L )
16. Exonuclease III (E. coli) (New England BioLabs, catalog number: M0206S/L )
17. Taq DNA Ligase (New England BioLabs, catalog number: M0208S/L )
18. Phusion^® High-Fidelity DNA Polymerase (New England BioLabs, catalog number: M0530S/L )
19. DpnI (New England BioLabs, catalog number: R0176S/L )
20. Nuclease free water (e.g., New England BioLabs, catalog number: B1500S/L )
21. Molecular biology grade Dithiothreitol (DTT) (e.g., GoldBio, catalog number: DTT10 )
22. 10x CutSmart^® Buffer (New England Biolabs, catalog number: B7204S )
23. SYBR Safe DNA gel stain (Thermo Fisher, catalog number: S33102 )
24. 5x HF Buffer (included with Phusion^® polymerase) (New England Biolabs, catalog number: B0518S )
25. 10 mM Adenosine 5’-Triphosphate (ATP) (e.g., New England BioLabs, catalog number: P0756S/L ) prepared in single-use aliquots of 10 μl
26. 10 mM Deoxynucleotide (dNTP) Solution Mix (e.g., New England BioLabs, catalog number: N0447S )
27. β-Nicotinamide adenine dinucleotide (NAD⁺) (50 mM) (e.g., New England BioLabs, catalog number: B9007S ) prepared in single-use aliquots of 10 μl
28. Single-use aliquots (see Recipes)
    10 mM ATP
    50 mM NAD⁺
    10 mM dNTPs
29. 50 mM DTT (see Recipes)
    

Equipment

1. -20 °C freezer
2. Pipettes
3. Thermal Cycler (e.g., Eppendorf, model: Mastercycler^TM pro, catalog number: 950040025 )
4. Microcentrifuge (e.g., Fisher, model: accuSpin microcentrifuge 17 , catalog number 13-100-675 ; does not need to be refrigerated)
5. Electroporator (e.g., Eppendorf Eporator^®, catalog number: 4309000027 )

Software

1. Python
   For making large numbers of specific mutations at many different amino acid positions, automated primer design software is indispensable. We provide a flexible python script for automated primer design in the supplementary information. This script can design mutagenic primers either using a user-specified degenerate codon (e.g., NNK), or by generating one or more mutation specific primers using common codons for a specified organism. The outputs from the script can be specified as tab-delimited or comma-separated values (CSV) files with programmable primer naming. Finally, the script facilitates precise specifications of which residues to mutate using the resfile format from the Rosetta macromolecular modeling suite (Leaver-Fay et al., 2011). Below, we provide some basic examples of inputs and command lines for the script.
       The software is written such that the 5′ and 3′ arm lengths are constant, either at a user defined length or a default length of 30 bases. Constant oligonucleotide lengths result in differential melting temperatures for individual members of the oligo pool and is a compromise with length and cost restrictions for oligo pool synthesis. Within a fixed-length pool, the primers with the highest predicted melting temperatures appear to be incorporated up to tenfold more efficiently than those with the lowest predicted melting temperatures (Medina-Cucurella et al., 2019), but the bias is tolerable for all end-uses in our laboratory.
       The only required input to the script is a plain text file containing three lines. The first line should contain sequence of the coding sequence of the gene to mutagenize (at least the length of the 5′ homology arm length), the second line should contain the coding sequence (CDS) to mutagenize without a stop codon, and the third line should contain the stop codon and sequence downstream of the coding sequence to mutagenize (at least the length of the 3′ homology arm length). The additional sequence is required in order to design primers that mutagenize the first and last few amino acids, the amount of additional sequence is dependent on the desired 5′ and 3′ arm lengths for the mutagenic primers. The full list of command-line flags is shown in Table S1.
   
   Suppose we want to mutagenize the amino acid sequence MVTAGENSIS, which is encoded (CDS; bold) within the following DNA sequence:
   ATAGACAGTAATGGTGACCGCGGGCGAAAACGAAAGCATTAGCTAGACAGTTG
   
   The input file (input.seq) we would use with the script would be:
   ATAGACAGTA
   ATGGTGACCGCGGGCGAAAACGAAAGCATTAGC
   TAGACAGTTG
   (The CDS is shown in boldface for clarity.) Note that the third line includes the TAG stop codon.
   
   Example 1:
   Make every possible amino acid mutation (including wild-type) at every position in the coding sequence. Generate two primers for each mutation, using the two most common codons in yeast for the mutant amino acid. Design each primer with 28 basepairs of homology to the template before and after the mismatched codon. Output a CSV to the file primers.csv.
   python nm_primers.zip --five-prime-arm-length 28 --three-prime-arm-length 28 --organism yeast --separator comma --output primers.csv input.seq
   
   Example 2:
   Mutate each residue using the degenerate codon NNK. Output a tab-separated file to primers.tsv. Design each primer with 20 base pairs homology upstream of the mutation and 30 basepairs homology downstream of the mutation.
   python nm_primers.zip --five-prime-arm-length 20 --three-prime-arm-length 30 --custom-codon NNK --separator tab –output primers.tsv input.seq
   

Procedure