Materials and Reagents

1. 0.1-10 μl pipet tips (Thermo Fisher Scientific, catalog number: QSP# TF104 )
   
2. 1-200 μl and 100-1,000 μl pipet tips (Corning, catalog number: 4845 and 4846 , respectively)
   
3. 0.2 ml 8 strips PCR tubes and caps (NIPPON Genetics, catalog number: FG-028DC )
   
4. 1.5 ml and 2.0 ml microcentrifuge tubes (Corning, catalog number: MCT-150-A and MCT-200-C , respectively)
   
5. 15 ml and 50 ml centrifuge tubes (Corning, catalog number: 352096 and 352070 , respectively)
   
6. 96-well fast plate (NIPPON Genetics, catalog number: 38801 )
   
7. 1 ml syringe (MonotaRO Co., NIPRO Genetics, catalog number: 08-010 )
   
8. Human hepatocyte-chimeric mice (PhoenixBio Co.)
   Note: Chimeric mice are intravenously infected with 100 μl of HBV-C in saline solution (10⁶ copies per mouse) derived originally from patient with chronic hepatitis (Sugiyama et al., 2006).
   
9. HBV (genotype C; HBV-C) (Dr. Yasuhito Tanaka, Department of Virology and Liver Unit, Nagoya City University Graduate School of Medical Sciences, Nagoya, Japan; Sugiyama et al., 2006)
   
10. Sodium chloride (Nacalai tesque, catalog number: 31320-05 )
    
11. YSK lipid (a pH-sensitive cationic lipid) (Faculty of Pharmaceutical Sciences, Hokkaido University, Sapporo, Hokkaido, Japan) (Sato et al., 2012)
    
12. Cholesterol (Avanti Polar Lipid, catalog number: 57-88-5 )
    
13. 1, 2-dimyristoyl-sn-glycerol methoxypolyethyleneglycol (PEG-DMG) (NOF Corporation, catalog number: GM-020 )
    
14. Nuclease free-H₂O
    
15. Citrate buffer (12.5 mM citrate, 500 mM NaCl)
16. pCpGfree-mcs vector (Invivogen)
    
17. Primers for vector construction
    pLKO.1 Fw SpeI: CCCACTAGTTTTCCCATGATTCCTTCATATTT
    pLKO.1 Rv BglII: CCCAGATCTAAAATTGTGGATGAATACTGCC
    
18. TaqMan Universal PCR Master Mix (Life Technologies, catalog number: 4304437 )
    Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4304437”.
    
19. Primers and probe for quantification of HBV DNA from HBV-infected chimeric mice sera:
    Forward Primer: SF2: 5’-CTTCATCCTGCTGCTATGCCT-3’
    Reverse Primer: SR2: 5’-AAAGCCCAGGATGATGGGAT-3’
    Probe: SP2: FAM-ATGTTGCCCGTTTGTCCTCTAATTCCAG-TAMRA
    
20. MISSION^® pLKO.1-puro Empty Vector Control Plasmid DNA (Sigma-Aldrich, catalog number: SHC001 )
    
21. DNA oligo nucleotides (5’-3’)
    Sense: CCGGTGTACATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTTTTG
    Antisense:
    AATTCAAAAATGTCCATGCCCCAAAGCCACCCAAGGCACAGCTTGGAGGCTTGAACAGTGGGACATGTACA
    
22. Oligo nucleotides (see Recipes)
    

Equipment

1. Biosafety hood in a biosafety level 3 (BSL3) facility (HITACHI, catalog number: SCV-1303 ECIIB )
   
2. Pipettes (PIPETMAN P2, P20 and P1000) (Gilson Scientific, catalog number: F144801 , F123600 and F123602 , respectively)
   
3. qPCR adhesive seal (NIPPON Genetics, catalog number: 4Ti-0560 )
   
4. Applied Biosystems Veriti Thermal Cycler (Life Technologies, catalog number: 4375786 )
   Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4375786”.
   
5. ABI StepOnePlusTM Real-Time PCR Systems (Life Technologies, catalog number: 4379216 )
   Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4379216”.

Procedure