Materials and Reagents

1. Escherichia coli (E. coli) OP50 [available from the Caenorhabditis Genetics Center (CGC)]
   
2. Anti–FLAG M2 affinity gel (Sigma-Aldrich, catalog number: A2220 )
   
3. 1-Bromo-3-chloropropane (BCP) (Sigma-Aldrich, catalog number: B9673 )
   
4. 1 M CaCl₂ solution (Sigma-Aldrich, catalog number: 21114 )
   
5. Distilled water (DNase/RNase-free UltraPure^TM) (Life Technologies, Invitrogen^TM, catalog number: 10977-015 )
   
6. 10 mM dNTP mix (Thermo Fisher Scientific, catalog number: R0191 )
   
7. EDTA (0.5 M, pH 8.0) UltraPure^TM (Life Technologies, Invitrogen^TM, catalog number: 15575-020 )
   
8. Ethanol 200 proof (for molecular biology) (Sigma-Aldrich, catalog number: E7023 )
   
9. FLAG peptide (Sigma-Aldrich, catalog number: F4799 )
   
10. Glycerol (Sigma-Aldrich, catalog number: G5516 )
    
11. GlycoBlue^TM coprecipitant (15 mg/ml) (Life Technologies, Ambion^®, catalog number: AM4530)
    
12. 100x halt protease inhibitor cocktail (Thermo Fisher Scientific, catalog number: 78430 )
    
13. Isopropanol (2-propanol, for molecular biology) (Sigma-Aldrich, catalog number: I9516 )
    
14. KH₂PO₄ (Sigma-Aldrich, catalog number: P0662 )
    
15. 8 M LiCl solution (Sigma-Aldrich, catalog number: L7026 )
    
16. Maxima reverse transcriptase (Thermo Fisher Scientific, catalog number: EP0741 )
    
17. 1 M MgCl₂ solution (Sigma-Aldrich, catalog number: M1028 )
    
18. 1 M MgSO₄ solution (Sigma-Aldrich, catalog number: M3409 )
    
19. Na₂HPO₄ (Sigma-Aldrich, catalog number: S3264 )
    
20. 5 M NaCl solution (Life Technologies, Ambion^®, catalog number: AM9759 )
    
21. NP-40 [10% (w/v) aqueous solution] (Pierce Antibodies, catalog number: 85124 )
    
22. Paraformaldehyde (32% solution, EM grade) (VWR International, catalog number: 15714-S )
    
23. Phase lock gel heavy (1.5 ml) (5PRIME, catalog number: 2302810 )
    
24. Phenol:Chloroform:IAA (25:24:1, pH 6.6) (Life Technologies, Ambion^®, catalog number: AM9730 )
    
25. Proteinase K (~20 mg/ml) (recombinant) (PCR grade) (Thermo Fisher Scientific, catalog number: EO0491 )
    
26. 2x QuantiFast SYBR^® Green qPCR master mix (QIAGEN, catalog number: 204154 )
    
27. Random hexamers (100 µM) (Thermo Fisher Scientific, catalog number: SO142 )
    
28. RNase inhibitor SUPERase In^TM (20 U/μl) (Life Technologies, Ambion^®, catalog number: AM2694 )
    
29. 20% SDS solution (Life Technologies, Ambion^®, catalog number: AM9820 )
    
30. 3 M sodium acetate (pH 5.5) solution (Life Technologies, Ambion^®, catalog number: AM9740 )
    
31. Sodium deoxycholate stock solution [10% (w/v) in distilled water] (Pierce Antibodies, catalog number: 89904 )
    
32. TRI Reagent^® solution (Life Technologies, Ambion^®, catalog number: AM9738 )
    
33. 1 M Tris-HCl (pH 7.5) UltraPure^TM (Life Technologies, Invitrogen^TM, catalog number: 15567-027 )
    
34. Triton-X 100 detergent solution (Pierce Antibodies, catalog number: 85111 )
    
35. The sequence of primers used in Figure 1 to detect mes-4 pre-mRNA: Forward GGATACATCAATGGAGAAATGGA (spanning exon 2 and intron 3) and Reverse ACAACTCGCGTGAAATTTACTAC (spanning intron 3)
    Note: DNA oligos has been synthesized by Integrated DNA Technologies (IDT).
    
36. 1x M9 buffer (see Recipes)
    
37. Nuclei extraction buffer (see Recipes)
    
38. RIPA buffer (see Recipes)
    
39. TSE 150 buffer (see Recipes)
    
40. TSE 500 buffer (see Recipes)
    
41. TSE 1,000 buffer (see Recipes)
    
42. LiCl buffer (see Recipes)
    
43. TE buffer (see Recipes)
    
44. Elution buffer (see Recipes)
    

Equipment

1. 1.5 ml Bioruptor TPX^® polymethylpentene tubes (Diagenode, catalog number: M500-50 )
   
2. Microfuge tubes (1.5 ml, RNase free) (Life Technologies, Invitrogen^TM, catalog number: AM12400 )
   
3. Bioruptor^® standard UCD-200 sonicator (Diagenode, catalog number: B01010003 )
   
4. Dura-Grind^TM stainless steel dounce tissue grinder 7 ml size (Wheaton Scientific, catalog number: 357572 )
   
5. Real-time PCR machine (e.g. Eppendorf, Mastercycler^® ep realplex⁴)
   
6. Refrigerated tabletop microcentrifuge
   
7. Labquake^TM tube rotators (Thermo Fisher Scientific, catalog number: 400220Q )
   
8. Vortex
   

Procedure