This protocol describes the basic principle of PCR/restriction digest genotyping of point mutations in worms, based on the principle of Restriction Fragment Length Polymorphism (RFLP) analysis. This type of genotyping is, particularly, useful when phenotypic analysis of animals carrying point mutations is difficult (e.g., in a complex genetic background).
I will illustrate the general procedures, using an example of daf-2 gene, encoding the sole insulin/IGF-1 receptor of C. elegans. Gems et al.(1998) did a very elegant job and characterized a series of mutations of daf-2, including the following two temperature-sensitive hypomorphic alleles:
daf-2(e1370): Substitution C/T (wild type/mutant), amino acid change: Missense P to S
Flanking sequences:
5’-CTCTATGAAATGGTTACACTCGGTGCTCAGCATATATTGGTTTGAGTAATGAGGTGT
Intracellular kinase domain, Class I, strong phenotype.
daf-2(e1368): Substitution C/T (wild type/mutant), amino acid change: Missense S to L
Flanking sequences:
5’-TCCGGAATTTACGTATTGAGGCAAAGTACTGTTCAGAAATVTATATGCTATCACAGT
Extracellular ligand binding domain, Class II, weak phenotype.
Here I will show you how to design the primers for PCR-RFLP analysis.
daf-2(e1370): Designed by Seung-Jae Lee from the Kenyon lab
Forward primer: 5’-CGGGATGAGACTGTCAAGATTGGAGATTTCGG-3’
Reverse primer: 5’-CAACACCTCATCATTACTCAAACCAATCCATG-3’
On the (-) strand, the nucleotide next to the 3’ end of reverse primer is G in wild-type allele, which is mutated to T in daf-2(e1370). Thus, by introducing another mutation (double C here, highlighted) into the reverse primer, it creates an Nco I-restriction site (i.e., CCATGG) only for PCR products derived from wild-type but NOT daf-2(1370).
daf-2(e1368): Designed by Peichuan Zhang from the Kenyon lab
Forward primer: 5’-GTTCCGGAATTTACGACGTATTGAGGCAACG-3’
Reverse primer: 5’-CTATCGGATCGAGTGGTATATTTAAC-3’
Similarly, on the (+) strand, the nucleotides next to the 3’ end of forward primer are TC in wild-type allele, and TT in daf-2(e1368). Thus, by introducing another mutation (C here, highlighted) into the forward primer, a restriction site of Acl I (i.e., AACGTT) is generated in the presence of daf-2(1368) point mutation.
The key is to introduce new mutation(s) at the 3’ end of one of your primers. Since the difference of the sizes of digest products is just ~30-bp, the length of the primer, you have to pick the other primer to generate an amplicon of ~200-bp – 250-bp or so.
Here is a website that can help you design the primers with appropriate restriction site for genotyping: http://helix.wustl.edu/dcaps/dcaps.html (dCAPS Finder 2.0) (Neff et al., 2002).

C. elegans (线虫)

PCR genotyping (PCR基因分型)

Point mutation (点突变)