Materials and Reagents

1. Virus supernatants (previously titrated)
   
2. XL-1 Blue competent bacterial cells (Stratagene, catalog Number: 200249 )
   
3. Dulbecco modified Eagle medium (DMEM) (Sigma-Aldrich, catalog number: D5523 )
   
4. Fetal Bovine Serum (Sigma-Aldrich, catalog number: F7524 )
   
5. Vero Cells (ATCC, catalog number: CCL-81 ^TM)
   
6. Alveolar swine macrophages (Carrascosa et al., 1982)
   
7. Swine serum (obtained during the macrophages purification)
   
8. Kapa HiFi polymerase (Kapa Biosystems, catalog number: KK2101 )
   Note: This polymerase kit includes buffer and dNTPs.
   
9. Primer B646L forward (Sigma-Aldrich)
   5’ATGGCATCAGGAGGAGCTTTTTGTCTTATT
   
10. Primer B646L reverse (Sigma-Aldrich)
    5’TTAGGTACTGTAACGCAGCACAGCTGAACCG
    
11. CloneJet PCR Cloning Kit (Thermo Fisher Scientific, catalog number: K1231 )
    Note: This kit includes the pJET plasmid, DNA ligase and reaction buffer.
    
12. Agarose for DNA electrophoresis (Lonza, SeaKem^® LE Agarose, catalog number: 50000 )
    
13. TAE buffer (Sambrook and Russell, 2001)
    
14. TE buffer (pH 8.0) (Sambrook and Russell, 2001)
    
15. 5x Agarose Gel loading dye (QIAGEN, catalog number: 239901 )
    
16. QIAquick gel extraction kit (QIAGEN, catalog number: 28704 )
    
17. LB-agar plates (Sambrook and Russell, 2001)
    
18. Ampicillin (Sigma-Aldrich, catalog number: A0166 )
    
19. Double-distillated or Milli-Q water
    

Equipment

1. MW24 plates (BD Biosciences, Falcon^®, catalog number: 353047 )
   
2. 1.5 ml Eppendorf tubes
   
3. Cell culture incubator
   
4. Refrigerated benchtop centrifuge (e.g. Hettich 200 R)
   
5. Thermal-cycler for PCR
   
6. Electrophoresis system for agarose gels and UV-documentation device to visualize the DNA bands
   
7. Waterbath
   

Software

1. Diverse bioinformatics software (e.g., Geneious or CLC Genomics Workbench) (optional)
   
2. MS Excel, Prism Graph Pad or SPSS (optional)
   

Procedure