Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from 43 pairs of fresh clinical lung tumor tissues with matched adjacent normal lung tissues using TRIzol reagent (ThermoFisher Scientific, Waltham, MA, USA). RNA in the aqueous phase was precipitated using trichloromethane, isopropanol, and 70% ethanol. Reverse transcription was performed using PrimeScriptRT Reagent Kits with gDNA Eraser (Takara Bio, Beijing, China). qRT-PCR was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using SYBR Green PCR Master Mix (Takara Bio) in 20 μl final volume with the following thermocycling conditions: 95 °C for 30 s, followed by 45 cycles at 95 °C for 5 s, then 60 °C for 30 s. A melting curve was generated to confirm the specificity of amplification. Relative gene expression was calculated using the 2^−ΔΔCt method with ACTB as the internal control. The primer sequences used were as follows: KLHL38 (forward) 5′–GGCCCTCATGGTTTGGATCA–3′ and (reverse) 5′–ATCGTTGGCGATGAAGTGGT–3′; ACTB (forward) 5′–ATAGCACAGCCTGGATAGCAACGTAC–3′ and (reverse) 5′–CACCTTCTACAATGAGCTGCGTGTG–3′; PTEN (forward) 5′–CCCAGTTTGTGGTCTGCCAGC–3′ and (reverse) 5′–ATGAGCTTGTCCTCCCGCCG–3′. Dissolution curves ensured the validity of amplification. All experiments were performed in triplicate.