Tail clips were taken from neonatal mice to identify genotypes before euthanasia. These tail clips were lysed in 75 µl of 25‐mM NaOH, 200‐µM EDTA (pH 12) in a 95°C heat block for 1 h, with manual dissociation at 30 min. 75‐µl neutralization buffer (40 mM Tris‐HCl, pH 5) was then added before DNA was used for genotyping reactions. PIWIL2‐eGFP mice were assayed for the presence of the transgene using primers specific to eGFP (forward: 5ʹ‐CTGACTCCTGATGAAGTGTTATAGCC‐3ʹ, reverse: 5ʹ‐TCCTTGAAGAAGATGGTGCGCTCCT‐3ʹ). Presence of a band at ~500 bp signified the presence of the transgene. STRA8 presence was detected using primer 1: 5ʹ‐AGCTGCAGAAGCTTGAGCCT‐3ʹ; primer 2: 5ʹ‐AGGTCAGGCTGCTAGGATGC‐3ʹ; and primer 3: 5ʹ‐TCCGATAGCTTGGCTGCAGGTC‐3ʹ. Wild‐type Stra8 results in a band at ~280 bp, and the Stra8 KO produces a band at ~180 bp.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.