Quantitative real-time PCR (qPCR)

MC Mingjiao Chen
MZ Meng Zhou
YF Yao Fu
JL Jin Li
ZW Zi Wang
ask Ask a question
Favorite

Extract Reagent test kit (Yi Shan Co., Shanghai) was used to obtain total mRNA, and reverse transcription reagent test kit (TAKARA) was used to get cDNA. 0.1 μL cDNA and 5 μL Power SYBR Green PCR Master Mix (Biosystems, Foster, CA, USA) with 1 μL primers (VEGF: forward: GCTCGGTGCTGGAATTTGAT, reverse: GCCCGATTCAAGTGGGGAAT; SDF-1: forward: ATTCTCAACACTCCAAACTGTGC, reverse: ACTTTAGCTTCGGGTCAATGC; FGF: forward: AAATCGCTATCTTGCTATGAAGGA, reverse: GTTCGTTTCAGTGCCACATACC; ANGPT: forward: ACCCCACTGTTGCTAAAGAAGA, reverse: CCATCCTCACGTCGCTGAATA; GAPDH: forward: AAGAAACCCTGGACCACCCAGC, reverse: TGGTATTCGAGAGAAGGGAGGG) in 3.9 μL double distilled water were mixed and added in the plate. Quant Studio™ 6 Flex Real Time PCR System (Biosystems) was used to carry out the expression, and the results were analyzed according to 2–ΔΔCT method [38].

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A