Immunostaining and RNA in situ experiments
This protocol is extracted from research article:
Structure and function of an ectopic Polycomb chromatin domain
Sci Adv, Jan 9, 2019; DOI: 10.1126/sciadv.aau9739

The procedure for antibody staining of imaginal discs has been described previously (8). Rabbit anti-En (1:500; SC 28640, Santa Cruz Biotechnology Inc.) and mouse anti-HA (1:100; PRB-101C, Abcam) were used for the immunostaining experiments.

For RNA in situ, we used pBS II SK(+) plasmid for cloning PCR fragments amplified by the following primers: yellow, GGGGGTACCCGGAGCTAATTCCGTATCCA and GGGGGATCCTCTTCCGTCCTGGTTTCATC; Msp300, GGGGGTACCACATAGCCCAAACGGAACAG and GGGGGATCCGCCTGCTTCTTCTCATCCAG; CG1504, GGGGGATCCAGAACCTGTCGACCATCCTG and GGGGGTACCCCGTCGAGTAGGGTGTGAAT; and CG1631, GGGGGTACCCTGCCAATTCCAGAGACCAG and GGGGGATCCGCCCTACTCAAAAAGCTCCA. Digoxigenin-labeled RNA antisense probe synthesis and whole-mount in situ hybridization were carried out as previously described (38).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.