DNA pull-down assays

A random oligonucleotide of sixty basepairs was produced and annealed with a complementary oligonucleotide in Annealing Buffer (50 mM HEPES pH 7.5, 50 mM KCl). This oligonucleotide is referred to throughout the paper as ‘dsDNA’ and has sequence:

5’-GAAGCTAGACTTAGGTGTCATATTGAACCTACTATGCCGAACTAGTTACGAGCTATAAAC −3’. For DNA pull down assays, dsDNA was produced with a 5’ biotin label (biotin-dsDNA, IDT). To generate DNA-coupled agarose beads, high capacity streptavidin agarose resin (Pierce) was first washed with Annealing Buffer and then 25 µM biotin-dsDNA was added to the beads and incubated for 1 hr at room temperature; control beads were generated by adding Annealing Buffer alone. Following coupling, the beads were washed three times with Annealing Buffer. To assay DNA binding, the beads were first washed three times with Assay Buffer (50 mM HEPES pH 7.5, 150 mM KGlutamate, 10% glycerol, 1 mM BME) and then 10 µM Cdt1 or Cdc6 was added to control and DNA coupled beads (Cdc6 binding was assessed in the presence and absence of 500 µM ATP). The beads were incubated with protein for 1 hr at room temperature and then washed three times with 10x volume of Assay Buffer before resuspending and boiling the beads in Laemmmli sample buffer and assessing bound proteins by SDS-PAGE analysis and Coomassie staining.